Incidental Mutation 'R5165:Olfr1276'
ID395635
Institutional Source Beutler Lab
Gene Symbol Olfr1276
Ensembl Gene ENSMUSG00000063844
Gene Nameolfactory receptor 1276
SynonymsMOR245-10, GA_x6K02T2Q125-72308574-72309512
MMRRC Submission 042746-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5165 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111254516-111262026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111257223 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 36 (V36E)
Ref Sequence ENSEMBL: ENSMUSP00000151987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073322] [ENSMUST00000218065]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073322
AA Change: V36E

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073046
Gene: ENSMUSG00000063844
AA Change: V36E

DomainStartEndE-ValueType
Pfam:7tm_4 30 304 9.7e-40 PFAM
Pfam:7tm_1 41 287 4.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213658
Predicted Effect possibly damaging
Transcript: ENSMUST00000218065
AA Change: V36E

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 T A 6: 83,526,832 I77F probably benign Het
Actl6a G A 3: 32,720,208 V285I probably benign Het
Adam9 A T 8: 24,967,174 I646N possibly damaging Het
Ahnak T C 19: 9,015,665 I4771T possibly damaging Het
Alas1 T C 9: 106,241,255 T223A probably damaging Het
Apc2 A G 10: 80,315,850 E2246G probably damaging Het
Atp1a1 A G 3: 101,581,789 I795T probably benign Het
Cdhr4 T C 9: 107,997,630 L633P probably damaging Het
Cep350 A G 1: 155,928,368 S990P probably damaging Het
Cplx2 A G 13: 54,378,976 I66V possibly damaging Het
Cx3cl1 T C 8: 94,779,876 S170P probably benign Het
Cyth1 T C 11: 118,169,082 N353S possibly damaging Het
Dapp1 T C 3: 137,939,215 probably null Het
Dmwd G A 7: 19,078,035 probably benign Het
Dsg1c A G 18: 20,277,023 H516R probably damaging Het
Efemp2 T C 19: 5,475,411 C39R probably damaging Het
Fnbp4 C G 2: 90,777,657 Q908E possibly damaging Het
Foxred2 A G 15: 77,956,012 V26A probably damaging Het
Gkap1 A G 13: 58,263,196 probably null Het
Gstcd A C 3: 133,084,679 V109G probably damaging Het
Hoxc9 T A 15: 102,984,000 M215K probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnj9 A T 1: 172,323,157 D296E probably benign Het
Kctd18 T C 1: 57,959,236 Y68C probably damaging Het
Kif21a A T 15: 90,956,376 M1179K probably benign Het
Lrfn5 T C 12: 61,839,624 I66T possibly damaging Het
Lrp12 A G 15: 39,872,461 S692P probably benign Het
Lrrc10 A T 10: 117,046,060 N213I probably benign Het
Mettl11b A G 1: 163,722,523 I53T probably benign Het
Nceh1 G A 3: 27,241,528 V313I probably benign Het
Nkx6-3 T A 8: 23,153,743 H53Q probably damaging Het
Nov A G 15: 54,749,189 D198G probably damaging Het
Olfr128 A G 17: 37,924,361 D265G probably benign Het
Olfr1388 A G 11: 49,444,376 H175R probably damaging Het
Olfr1447 A T 19: 12,901,200 N193K probably benign Het
Oxct1 A T 15: 4,053,769 T157S possibly damaging Het
Pcdhga3 A G 18: 37,675,670 E392G possibly damaging Het
Polr1a T G 6: 71,967,925 Y1322D probably damaging Het
Prkdc T A 16: 15,678,272 S776T probably damaging Het
Ralgapb A G 2: 158,465,912 I1047V possibly damaging Het
Sertad4 A T 1: 192,846,822 S229T possibly damaging Het
Shank2 T A 7: 144,409,636 V327D possibly damaging Het
Skint6 A T 4: 112,865,668 V904E possibly damaging Het
Slfn8 A T 11: 83,017,127 Y197N probably damaging Het
Smo T A 6: 29,736,078 L23Q unknown Het
Snx29 T A 16: 11,420,775 M23K probably damaging Het
Synrg T C 11: 83,990,935 S366P probably benign Het
Tomm40 A G 7: 19,713,667 probably null Het
Tpcn1 T C 5: 120,557,945 E81G probably damaging Het
Trappc1 A G 11: 69,324,234 Q26R probably benign Het
Ttn T A 2: 76,776,556 probably null Het
Usp25 T A 16: 77,076,405 D450E possibly damaging Het
Zmynd19 T A 2: 24,958,189 Y132* probably null Het
Other mutations in Olfr1276
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02339:Olfr1276 APN 2 111257243 missense probably benign 0.00
IGL03298:Olfr1276 APN 2 111257534 missense probably benign
R0022:Olfr1276 UTSW 2 111257649 missense probably benign 0.30
R0254:Olfr1276 UTSW 2 111257121 missense probably benign 0.13
R3903:Olfr1276 UTSW 2 111257769 missense probably damaging 1.00
R4801:Olfr1276 UTSW 2 111257152 missense probably damaging 1.00
R4802:Olfr1276 UTSW 2 111257152 missense probably damaging 1.00
R5341:Olfr1276 UTSW 2 111257637 missense probably damaging 1.00
R5619:Olfr1276 UTSW 2 111257511 missense probably damaging 1.00
R7761:Olfr1276 UTSW 2 111257174 missense possibly damaging 0.93
R8181:Olfr1276 UTSW 2 111257573 missense probably benign
Z1088:Olfr1276 UTSW 2 111257859 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAAGGGCTTTGCTAATTGAGGG -3'
(R):5'- TGAGATGGTATTATGCCCAGAG -3'

Sequencing Primer
(F):5'- GTAAGCACCTACTCCTTTTGAAC -3'
(R):5'- TATTATGCCCAGAGGACAGGTC -3'
Posted On2016-06-21