Mutagenetix > Incidental Mutations

Incidental Mutation 'R5165:Ralgapb'

395636

Institutional Source

Beutler Lab

Gene Symbol

Ralgapb

Ensembl Gene

ENSMUSG00000027652

Gene Name

Ral GTPase activating protein, beta subunit (non-catalytic)

Synonyms

B230339M05Rik

MMRRC Submission

042746-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5165 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

158409848-158499253 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 158465912 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1047 (I1047V)

Ref Sequence

ENSEMBL: ENSMUSP00000105111 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046274] [ENSMUST00000109485] [ENSMUST00000109486] [ENSMUST00000141497]

Predicted Effect

probably benign
Transcript: ENSMUST00000046274
AA Change: I1031V

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000048430
Gene: ENSMUSG00000027652
AA Change: I1031V

Domain	Start	End	E-Value	Type
low complexity region	166	178	N/A	INTRINSIC
low complexity region	610	625	N/A	INTRINSIC
low complexity region	775	788	N/A	INTRINSIC
low complexity region	910	920	N/A	INTRINSIC
low complexity region	1086	1097	N/A	INTRINSIC
low complexity region	1309	1321	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109485
AA Change: I1047V

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105111
Gene: ENSMUSG00000027652
AA Change: I1047V

Domain	Start	End	E-Value	Type
low complexity region	166	178	N/A	INTRINSIC
low complexity region	622	637	N/A	INTRINSIC
low complexity region	791	804	N/A	INTRINSIC
low complexity region	926	936	N/A	INTRINSIC
low complexity region	1102	1113	N/A	INTRINSIC
low complexity region	1325	1337	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109486
AA Change: I1035V

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000105112
Gene: ENSMUSG00000027652
AA Change: I1035V

Domain	Start	End	E-Value	Type
low complexity region	166	178	N/A	INTRINSIC
low complexity region	610	625	N/A	INTRINSIC
low complexity region	779	792	N/A	INTRINSIC
low complexity region	914	924	N/A	INTRINSIC
low complexity region	1090	1101	N/A	INTRINSIC
low complexity region	1313	1325	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122256

Predicted Effect

probably benign
Transcript: ENSMUST00000141497
AA Change: I713V

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000116481
Gene: ENSMUSG00000027652
AA Change: I713V

Domain	Start	End	E-Value	Type
low complexity region	288	303	N/A	INTRINSIC
low complexity region	457	470	N/A	INTRINSIC
low complexity region	592	602	N/A	INTRINSIC
low complexity region	768	779	N/A	INTRINSIC
low complexity region	991	1003	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150420

Meta Mutation Damage Score

0.0919

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

98% (58/59)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actg2	T	A	6: 83,526,832	I77F	probably benign	Het
Actl6a	G	A	3: 32,720,208	V285I	probably benign	Het
Adam9	A	T	8: 24,967,174	I646N	possibly damaging	Het
Ahnak	T	C	19: 9,015,665	I4771T	possibly damaging	Het
Alas1	T	C	9: 106,241,255	T223A	probably damaging	Het
Apc2	A	G	10: 80,315,850	E2246G	probably damaging	Het
Atp1a1	A	G	3: 101,581,789	I795T	probably benign	Het
Cdhr4	T	C	9: 107,997,630	L633P	probably damaging	Het
Cep350	A	G	1: 155,928,368	S990P	probably damaging	Het
Cplx2	A	G	13: 54,378,976	I66V	possibly damaging	Het
Cx3cl1	T	C	8: 94,779,876	S170P	probably benign	Het
Cyth1	T	C	11: 118,169,082	N353S	possibly damaging	Het
Dapp1	T	C	3: 137,939,215		probably null	Het
Dmwd	G	A	7: 19,078,035		probably benign	Het
Dsg1c	A	G	18: 20,277,023	H516R	probably damaging	Het
Efemp2	T	C	19: 5,475,411	C39R	probably damaging	Het
Fnbp4	C	G	2: 90,777,657	Q908E	possibly damaging	Het
Foxred2	A	G	15: 77,956,012	V26A	probably damaging	Het
Gkap1	A	G	13: 58,263,196		probably null	Het
Gstcd	A	C	3: 133,084,679	V109G	probably damaging	Het
Hoxc9	T	A	15: 102,984,000	M215K	probably damaging	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Kcnj9	A	T	1: 172,323,157	D296E	probably benign	Het
Kctd18	T	C	1: 57,959,236	Y68C	probably damaging	Het
Kif21a	A	T	15: 90,956,376	M1179K	probably benign	Het
Lrfn5	T	C	12: 61,839,624	I66T	possibly damaging	Het
Lrp12	A	G	15: 39,872,461	S692P	probably benign	Het
Lrrc10	A	T	10: 117,046,060	N213I	probably benign	Het
Mettl11b	A	G	1: 163,722,523	I53T	probably benign	Het
Nceh1	G	A	3: 27,241,528	V313I	probably benign	Het
Nkx6-3	T	A	8: 23,153,743	H53Q	probably damaging	Het
Nov	A	G	15: 54,749,189	D198G	probably damaging	Het
Olfr1276	T	A	2: 111,257,223	V36E	possibly damaging	Het
Olfr128	A	G	17: 37,924,361	D265G	probably benign	Het
Olfr1388	A	G	11: 49,444,376	H175R	probably damaging	Het
Olfr1447	A	T	19: 12,901,200	N193K	probably benign	Het
Oxct1	A	T	15: 4,053,769	T157S	possibly damaging	Het
Pcdhga3	A	G	18: 37,675,670	E392G	possibly damaging	Het
Polr1a	T	G	6: 71,967,925	Y1322D	probably damaging	Het
Prkdc	T	A	16: 15,678,272	S776T	probably damaging	Het
Sertad4	A	T	1: 192,846,822	S229T	possibly damaging	Het
Shank2	T	A	7: 144,409,636	V327D	possibly damaging	Het
Skint6	A	T	4: 112,865,668	V904E	possibly damaging	Het
Slfn8	A	T	11: 83,017,127	Y197N	probably damaging	Het
Smo	T	A	6: 29,736,078	L23Q	unknown	Het
Snx29	T	A	16: 11,420,775	M23K	probably damaging	Het
Synrg	T	C	11: 83,990,935	S366P	probably benign	Het
Tomm40	A	G	7: 19,713,667		probably null	Het
Tpcn1	T	C	5: 120,557,945	E81G	probably damaging	Het
Trappc1	A	G	11: 69,324,234	Q26R	probably benign	Het
Ttn	T	A	2: 76,776,556		probably null	Het
Usp25	T	A	16: 77,076,405	D450E	possibly damaging	Het
Zmynd19	T	A	2: 24,958,189	Y132*	probably null	Het

Other mutations in Ralgapb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ralgapb	APN	2	158420856	missense	probably damaging	1.00
IGL00534:Ralgapb	APN	2	158430500	missense	possibly damaging	0.72
IGL01362:Ralgapb	APN	2	158435465	missense	probably damaging	1.00
IGL01653:Ralgapb	APN	2	158462159	missense	possibly damaging	0.94
IGL01704:Ralgapb	APN	2	158420875	missense	possibly damaging	0.92
IGL02000:Ralgapb	APN	2	158454114	splice site	probably benign
IGL02169:Ralgapb	APN	2	158426204	missense	probably damaging	1.00
IGL02516:Ralgapb	APN	2	158465815	splice site	probably benign
IGL02548:Ralgapb	APN	2	158444665	missense	probably damaging	0.97
IGL02550:Ralgapb	APN	2	158448411	missense	probably damaging	1.00
IGL02653:Ralgapb	APN	2	158443309	missense	probably damaging	1.00
IGL02744:Ralgapb	APN	2	158446151	missense	probably damaging	1.00
IGL02804:Ralgapb	APN	2	158426284	missense	possibly damaging	0.78
IGL02937:Ralgapb	APN	2	158493016	splice site	probably null
IGL02993:Ralgapb	APN	2	158437394	missense	possibly damaging	0.90
IGL03154:Ralgapb	APN	2	158432866	missense	probably damaging	1.00
IGL03204:Ralgapb	APN	2	158465912	missense	possibly damaging	0.67
IGL03347:Ralgapb	APN	2	158465960	missense	possibly damaging	0.67
PIT4142001:Ralgapb	UTSW	2	158430422	missense	probably benign	0.34
R0037:Ralgapb	UTSW	2	158437411	missense	probably damaging	1.00
R0037:Ralgapb	UTSW	2	158437411	missense	probably damaging	1.00
R0077:Ralgapb	UTSW	2	158473249	missense	probably damaging	1.00
R0581:Ralgapb	UTSW	2	158492961	missense	probably benign
R0629:Ralgapb	UTSW	2	158439547	missense	probably damaging	1.00
R0839:Ralgapb	UTSW	2	158473283	critical splice donor site	probably null
R1331:Ralgapb	UTSW	2	158430533	missense	probably damaging	1.00
R1468:Ralgapb	UTSW	2	158462253	missense	possibly damaging	0.95
R1468:Ralgapb	UTSW	2	158462253	missense	possibly damaging	0.95
R1540:Ralgapb	UTSW	2	158465826	missense	probably benign	0.00
R1572:Ralgapb	UTSW	2	158446199	splice site	probably benign
R1628:Ralgapb	UTSW	2	158430463	missense	probably benign	0.04
R1718:Ralgapb	UTSW	2	158443280	nonsense	probably null
R1777:Ralgapb	UTSW	2	158462195	missense	probably damaging	1.00
R1822:Ralgapb	UTSW	2	158492452	missense	probably damaging	0.99
R1903:Ralgapb	UTSW	2	158495563	missense	probably benign	0.04
R1909:Ralgapb	UTSW	2	158444675	missense	probably damaging	1.00
R2157:Ralgapb	UTSW	2	158437472	missense	probably benign	0.15
R4524:Ralgapb	UTSW	2	158437306	missense	probably benign	0.00
R4946:Ralgapb	UTSW	2	158440967	missense	probably damaging	1.00
R4975:Ralgapb	UTSW	2	158435508	missense	possibly damaging	0.66
R5014:Ralgapb	UTSW	2	158495535	missense	probably damaging	1.00
R5465:Ralgapb	UTSW	2	158448405	missense	possibly damaging	0.81
R5526:Ralgapb	UTSW	2	158432785	missense	probably damaging	1.00
R5566:Ralgapb	UTSW	2	158494710	missense	possibly damaging	0.90
R5949:Ralgapb	UTSW	2	158454259	missense	probably damaging	1.00
R6140:Ralgapb	UTSW	2	158456572	missense	probably damaging	1.00
R6175:Ralgapb	UTSW	2	158446155	missense	probably damaging	1.00
R6192:Ralgapb	UTSW	2	158449447	splice site	probably null
R6364:Ralgapb	UTSW	2	158462109	missense	probably damaging	1.00
R6458:Ralgapb	UTSW	2	158444620	missense	probably damaging	1.00
R6746:Ralgapb	UTSW	2	158476136	missense	probably damaging	1.00
R6782:Ralgapb	UTSW	2	158436566	missense	probably damaging	0.99
R6788:Ralgapb	UTSW	2	158436566	missense	probably damaging	0.99
R7017:Ralgapb	UTSW	2	158448337	missense	probably benign	0.19
R7108:Ralgapb	UTSW	2	158492460	missense	probably damaging	0.98
R7108:Ralgapb	UTSW	2	158494662	missense	probably damaging	1.00
R7236:Ralgapb	UTSW	2	158440827	missense	probably benign	0.34
R7454:Ralgapb	UTSW	2	158432902	missense	possibly damaging	0.94
R7485:Ralgapb	UTSW	2	158443355	missense	probably benign	0.35
R7595:Ralgapb	UTSW	2	158426165	missense	possibly damaging	0.91
R7615:Ralgapb	UTSW	2	158450270	missense	probably damaging	0.99
R7728:Ralgapb	UTSW	2	158482503	critical splice donor site	probably null
R7913:Ralgapb	UTSW	2	158465939	missense	probably damaging	1.00
R7953:Ralgapb	UTSW	2	158465883	missense	probably benign	0.10
R8245:Ralgapb	UTSW	2	158443336	missense	probably damaging	0.96
R8337:Ralgapb	UTSW	2	158450272	missense	probably benign	0.11
R8363:Ralgapb	UTSW	2	158426199	missense	probably damaging	1.00
R8429:Ralgapb	UTSW	2	158426297	missense	probably damaging	1.00
Z1177:Ralgapb	UTSW	2	158435555	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGTGGTGATGATACATACACCTAGG -3'
(R):5'- GCTGATGGCAGTCACATACATC -3'

Sequencing Primer
(F):5'- CATTCAAGCAGACCAGGGGC -3'
(R):5'- GATGGCAGTCACATACATCTTCTTC -3'

Posted On

2016-06-21