Incidental Mutation 'R5165:Actg2'
ID395647
Institutional Source Beutler Lab
Gene Symbol Actg2
Ensembl Gene ENSMUSG00000059430
Gene Nameactin, gamma 2, smooth muscle, enteric
SynonymsAct4, Act-4, ACTA3, SMGA
MMRRC Submission 042746-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5165 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83512905-83536265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83526832 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 77 (I77F)
Ref Sequence ENSEMBL: ENSMUSP00000121577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075161] [ENSMUST00000121731] [ENSMUST00000141904] [ENSMUST00000152029] [ENSMUST00000205926]
Predicted Effect probably benign
Transcript: ENSMUST00000075161
AA Change: I77F

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000074658
Gene: ENSMUSG00000059430
AA Change: I77F

DomainStartEndE-ValueType
ACTIN 6 376 6.01e-236 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121731
AA Change: I77F

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113552
Gene: ENSMUSG00000059430
AA Change: I77F

DomainStartEndE-ValueType
ACTIN 6 376 6.01e-236 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124933
Predicted Effect probably benign
Transcript: ENSMUST00000141904
AA Change: I77F

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000120936
Gene: ENSMUSG00000059430
AA Change: I77F

DomainStartEndE-ValueType
ACTIN 6 270 4.78e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152029
AA Change: I77F

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121577
Gene: ENSMUSG00000059430
AA Change: I77F

DomainStartEndE-ValueType
ACTIN 6 195 1.09e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205926
Meta Mutation Damage Score 0.1446 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Actins are highly conserved proteins that are involved in various types of cell motility and in the maintenance of the cytoskeleton. Three types of actins, alpha, beta and gamma, have been identified in vertebrates. Alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton and as mediators of internal cell motility. This gene encodes actin gamma 2; a smooth muscle actin found in enteric tissues. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Based on similarity to peptide cleavage of related actins, the mature protein of this gene is formed by removal of two N-terminal peptides.[provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a G A 3: 32,720,208 V285I probably benign Het
Adam9 A T 8: 24,967,174 I646N possibly damaging Het
Ahnak T C 19: 9,015,665 I4771T possibly damaging Het
Alas1 T C 9: 106,241,255 T223A probably damaging Het
Apc2 A G 10: 80,315,850 E2246G probably damaging Het
Atp1a1 A G 3: 101,581,789 I795T probably benign Het
Cdhr4 T C 9: 107,997,630 L633P probably damaging Het
Cep350 A G 1: 155,928,368 S990P probably damaging Het
Cplx2 A G 13: 54,378,976 I66V possibly damaging Het
Cx3cl1 T C 8: 94,779,876 S170P probably benign Het
Cyth1 T C 11: 118,169,082 N353S possibly damaging Het
Dapp1 T C 3: 137,939,215 probably null Het
Dmwd G A 7: 19,078,035 probably benign Het
Dsg1c A G 18: 20,277,023 H516R probably damaging Het
Efemp2 T C 19: 5,475,411 C39R probably damaging Het
Fnbp4 C G 2: 90,777,657 Q908E possibly damaging Het
Foxred2 A G 15: 77,956,012 V26A probably damaging Het
Gkap1 A G 13: 58,263,196 probably null Het
Gstcd A C 3: 133,084,679 V109G probably damaging Het
Hoxc9 T A 15: 102,984,000 M215K probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnj9 A T 1: 172,323,157 D296E probably benign Het
Kctd18 T C 1: 57,959,236 Y68C probably damaging Het
Kif21a A T 15: 90,956,376 M1179K probably benign Het
Lrfn5 T C 12: 61,839,624 I66T possibly damaging Het
Lrp12 A G 15: 39,872,461 S692P probably benign Het
Lrrc10 A T 10: 117,046,060 N213I probably benign Het
Mettl11b A G 1: 163,722,523 I53T probably benign Het
Nceh1 G A 3: 27,241,528 V313I probably benign Het
Nkx6-3 T A 8: 23,153,743 H53Q probably damaging Het
Nov A G 15: 54,749,189 D198G probably damaging Het
Olfr1276 T A 2: 111,257,223 V36E possibly damaging Het
Olfr128 A G 17: 37,924,361 D265G probably benign Het
Olfr1388 A G 11: 49,444,376 H175R probably damaging Het
Olfr1447 A T 19: 12,901,200 N193K probably benign Het
Oxct1 A T 15: 4,053,769 T157S possibly damaging Het
Pcdhga3 A G 18: 37,675,670 E392G possibly damaging Het
Polr1a T G 6: 71,967,925 Y1322D probably damaging Het
Prkdc T A 16: 15,678,272 S776T probably damaging Het
Ralgapb A G 2: 158,465,912 I1047V possibly damaging Het
Sertad4 A T 1: 192,846,822 S229T possibly damaging Het
Shank2 T A 7: 144,409,636 V327D possibly damaging Het
Skint6 A T 4: 112,865,668 V904E possibly damaging Het
Slfn8 A T 11: 83,017,127 Y197N probably damaging Het
Smo T A 6: 29,736,078 L23Q unknown Het
Snx29 T A 16: 11,420,775 M23K probably damaging Het
Synrg T C 11: 83,990,935 S366P probably benign Het
Tomm40 A G 7: 19,713,667 probably null Het
Tpcn1 T C 5: 120,557,945 E81G probably damaging Het
Trappc1 A G 11: 69,324,234 Q26R probably benign Het
Ttn T A 2: 76,776,556 probably null Het
Usp25 T A 16: 77,076,405 D450E possibly damaging Het
Zmynd19 T A 2: 24,958,189 Y132* probably null Het
Other mutations in Actg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Actg2 APN 6 83523175 missense probably damaging 1.00
PIT4508001:Actg2 UTSW 6 83513007 missense possibly damaging 0.92
R0309:Actg2 UTSW 6 83519914 missense probably damaging 1.00
R0319:Actg2 UTSW 6 83520743 missense probably damaging 1.00
R1253:Actg2 UTSW 6 83522887 missense probably damaging 1.00
R1619:Actg2 UTSW 6 83523187 missense probably damaging 1.00
R1677:Actg2 UTSW 6 83522819 missense possibly damaging 0.92
R2512:Actg2 UTSW 6 83526847 missense probably damaging 1.00
R4127:Actg2 UTSW 6 83522884 missense possibly damaging 0.86
R4195:Actg2 UTSW 6 83523173 missense probably damaging 1.00
R5661:Actg2 UTSW 6 83520772 missense probably damaging 0.98
R6030:Actg2 UTSW 6 83516364 missense probably damaging 1.00
R6030:Actg2 UTSW 6 83516364 missense probably damaging 1.00
R6707:Actg2 UTSW 6 83513094 nonsense probably null
R7069:Actg2 UTSW 6 83520763 missense probably damaging 1.00
R7763:Actg2 UTSW 6 83527368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCTGTGGGAAGCCATTG -3'
(R):5'- CATTCCAGTGACTAAATCTGTGTG -3'

Sequencing Primer
(F):5'- GCCCAGGCTGGAAATGATTTAG -3'
(R):5'- ACTAAATCTGTGTGTGTGGACCCC -3'
Posted On2016-06-21