Incidental Mutation 'R5165:Dmwd'
ID395648
Institutional Source Beutler Lab
Gene Symbol Dmwd
Ensembl Gene ENSMUSG00000030410
Gene Namedystrophia myotonica-containing WD repeat motif
SynonymsDm9, 59, DMR-N9
MMRRC Submission 042746-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R5165 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19076227-19082776 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 19078035 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032570] [ENSMUST00000035521] [ENSMUST00000076887] [ENSMUST00000108479]
Predicted Effect probably benign
Transcript: ENSMUST00000032570
SMART Domains Protein: ENSMUSP00000032570
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 653 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035521
SMART Domains Protein: ENSMUSP00000046526
Gene: ENSMUSG00000040866

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 191 685 2.3e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076887
SMART Domains Protein: ENSMUSP00000076153
Gene: ENSMUSG00000040866

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:Radial_spoke 188 287 3e-18 PFAM
Pfam:Radial_spoke 285 433 4.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108479
SMART Domains Protein: ENSMUSP00000104119
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 628 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146429
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 T A 6: 83,526,832 I77F probably benign Het
Actl6a G A 3: 32,720,208 V285I probably benign Het
Adam9 A T 8: 24,967,174 I646N possibly damaging Het
Ahnak T C 19: 9,015,665 I4771T possibly damaging Het
Alas1 T C 9: 106,241,255 T223A probably damaging Het
Apc2 A G 10: 80,315,850 E2246G probably damaging Het
Atp1a1 A G 3: 101,581,789 I795T probably benign Het
Cdhr4 T C 9: 107,997,630 L633P probably damaging Het
Cep350 A G 1: 155,928,368 S990P probably damaging Het
Cplx2 A G 13: 54,378,976 I66V possibly damaging Het
Cx3cl1 T C 8: 94,779,876 S170P probably benign Het
Cyth1 T C 11: 118,169,082 N353S possibly damaging Het
Dapp1 T C 3: 137,939,215 probably null Het
Dsg1c A G 18: 20,277,023 H516R probably damaging Het
Efemp2 T C 19: 5,475,411 C39R probably damaging Het
Fnbp4 C G 2: 90,777,657 Q908E possibly damaging Het
Foxred2 A G 15: 77,956,012 V26A probably damaging Het
Gkap1 A G 13: 58,263,196 probably null Het
Gstcd A C 3: 133,084,679 V109G probably damaging Het
Hoxc9 T A 15: 102,984,000 M215K probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnj9 A T 1: 172,323,157 D296E probably benign Het
Kctd18 T C 1: 57,959,236 Y68C probably damaging Het
Kif21a A T 15: 90,956,376 M1179K probably benign Het
Lrfn5 T C 12: 61,839,624 I66T possibly damaging Het
Lrp12 A G 15: 39,872,461 S692P probably benign Het
Lrrc10 A T 10: 117,046,060 N213I probably benign Het
Mettl11b A G 1: 163,722,523 I53T probably benign Het
Nceh1 G A 3: 27,241,528 V313I probably benign Het
Nkx6-3 T A 8: 23,153,743 H53Q probably damaging Het
Nov A G 15: 54,749,189 D198G probably damaging Het
Olfr1276 T A 2: 111,257,223 V36E possibly damaging Het
Olfr128 A G 17: 37,924,361 D265G probably benign Het
Olfr1388 A G 11: 49,444,376 H175R probably damaging Het
Olfr1447 A T 19: 12,901,200 N193K probably benign Het
Oxct1 A T 15: 4,053,769 T157S possibly damaging Het
Pcdhga3 A G 18: 37,675,670 E392G possibly damaging Het
Polr1a T G 6: 71,967,925 Y1322D probably damaging Het
Prkdc T A 16: 15,678,272 S776T probably damaging Het
Ralgapb A G 2: 158,465,912 I1047V possibly damaging Het
Sertad4 A T 1: 192,846,822 S229T possibly damaging Het
Shank2 T A 7: 144,409,636 V327D possibly damaging Het
Skint6 A T 4: 112,865,668 V904E possibly damaging Het
Slfn8 A T 11: 83,017,127 Y197N probably damaging Het
Smo T A 6: 29,736,078 L23Q unknown Het
Snx29 T A 16: 11,420,775 M23K probably damaging Het
Synrg T C 11: 83,990,935 S366P probably benign Het
Tomm40 A G 7: 19,713,667 probably null Het
Tpcn1 T C 5: 120,557,945 E81G probably damaging Het
Trappc1 A G 11: 69,324,234 Q26R probably benign Het
Ttn T A 2: 76,776,556 probably null Het
Usp25 T A 16: 77,076,405 D450E possibly damaging Het
Zmynd19 T A 2: 24,958,189 Y132* probably null Het
Other mutations in Dmwd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Dmwd APN 7 19081234 splice site probably null
IGL01668:Dmwd APN 7 19081155 missense probably damaging 1.00
IGL02705:Dmwd APN 7 19080844 missense probably benign 0.02
IGL03036:Dmwd APN 7 19081129 missense probably damaging 1.00
IGL03133:Dmwd APN 7 19076637 missense probably damaging 1.00
PIT4305001:Dmwd UTSW 7 19080718 missense probably damaging 0.99
R0172:Dmwd UTSW 7 19080342 missense probably damaging 1.00
R1619:Dmwd UTSW 7 19081034 unclassified probably benign
R2055:Dmwd UTSW 7 19076685 missense probably benign 0.34
R2058:Dmwd UTSW 7 19080727 missense probably damaging 1.00
R2403:Dmwd UTSW 7 19081159 missense possibly damaging 0.94
R2922:Dmwd UTSW 7 19076345 missense probably damaging 1.00
R3122:Dmwd UTSW 7 19080695 missense probably damaging 1.00
R4876:Dmwd UTSW 7 19080547 missense probably damaging 1.00
R4937:Dmwd UTSW 7 19081303 critical splice donor site probably null
R5018:Dmwd UTSW 7 19078119 missense probably damaging 0.99
R5034:Dmwd UTSW 7 19080294 missense probably damaging 1.00
R5265:Dmwd UTSW 7 19080281 missense possibly damaging 0.89
R5559:Dmwd UTSW 7 19080438 missense probably damaging 0.99
R6695:Dmwd UTSW 7 19080727 missense probably damaging 1.00
R7106:Dmwd UTSW 7 19080529 missense probably damaging 1.00
R7208:Dmwd UTSW 7 19080309 missense probably benign 0.05
R7681:Dmwd UTSW 7 19081082 missense probably benign 0.23
R7683:Dmwd UTSW 7 19080735 missense probably damaging 1.00
R7760:Dmwd UTSW 7 19080735 missense probably damaging 1.00
R7763:Dmwd UTSW 7 19080340 missense probably damaging 1.00
R7814:Dmwd UTSW 7 19080843 missense probably benign 0.02
R8000:Dmwd UTSW 7 19080735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACAGCTGGAAAGACAGGCTC -3'
(R):5'- TGATGAGGTCCAGATACTGCAC -3'

Sequencing Primer
(F):5'- AAGACAGGCTCTGAGGTCTTCAC -3'
(R):5'- TCCAGATACTGCACCTGGC -3'
Posted On2016-06-21