Mutagenetix > Incidental Mutation

Incidental Mutation 'R0449:Birc6'

39565

Institutional Source

Beutler Lab

Gene Symbol

Birc6

Ensembl Gene

ENSMUSG00000024073

Gene Name

baculoviral IAP repeat-containing 6

Synonyms

D630005A10Rik, apollon, Bruce, A430032G04Rik, A430040A19Rik

MMRRC Submission

038649-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0449 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74528295-74703356 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 74692295 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 4673 (T4673P)

Ref Sequence

ENSEMBL: ENSMUSP00000138333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000180037] [ENSMUST00000182133] [ENSMUST00000182597] [ENSMUST00000182944] [ENSMUST00000183224]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000180037
AA Change: T4664P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136329
Gene: ENSMUSG00000024073
AA Change: T4664P

Domain	Start	End	E-Value	Type
low complexity region	24	54	N/A	INTRINSIC
BIR	287	363	2.87e-24	SMART
low complexity region	472	493	N/A	INTRINSIC
low complexity region	624	635	N/A	INTRINSIC
low complexity region	674	685	N/A	INTRINSIC
low complexity region	769	781	N/A	INTRINSIC
low complexity region	1054	1071	N/A	INTRINSIC
low complexity region	1369	1380	N/A	INTRINSIC
coiled coil region	1620	1675	N/A	INTRINSIC
low complexity region	1709	1726	N/A	INTRINSIC
low complexity region	1993	1998	N/A	INTRINSIC
low complexity region	2044	2059	N/A	INTRINSIC
low complexity region	2142	2163	N/A	INTRINSIC
low complexity region	2253	2266	N/A	INTRINSIC
low complexity region	2491	2505	N/A	INTRINSIC
low complexity region	2671	2688	N/A	INTRINSIC
low complexity region	2893	2905	N/A	INTRINSIC
low complexity region	2958	2970	N/A	INTRINSIC
Pfam:DUF3643	3477	3632	1e-69	PFAM
low complexity region	3747	3772	N/A	INTRINSIC
low complexity region	3900	3919	N/A	INTRINSIC
low complexity region	3940	3958	N/A	INTRINSIC
low complexity region	3963	3972	N/A	INTRINSIC
low complexity region	4146	4157	N/A	INTRINSIC
low complexity region	4307	4318	N/A	INTRINSIC
low complexity region	4433	4444	N/A	INTRINSIC
UBCc	4592	4756	1.04e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000182133
AA Change: T4658P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138693
Gene: ENSMUSG00000024073
AA Change: T4658P

Domain	Start	End	E-Value	Type
low complexity region	24	54	N/A	INTRINSIC
BIR	287	363	2.87e-24	SMART
low complexity region	472	493	N/A	INTRINSIC
low complexity region	624	635	N/A	INTRINSIC
low complexity region	674	685	N/A	INTRINSIC
low complexity region	769	781	N/A	INTRINSIC
low complexity region	1054	1071	N/A	INTRINSIC
low complexity region	1369	1380	N/A	INTRINSIC
coiled coil region	1620	1675	N/A	INTRINSIC
low complexity region	1709	1726	N/A	INTRINSIC
low complexity region	1993	1998	N/A	INTRINSIC
low complexity region	2044	2055	N/A	INTRINSIC
low complexity region	2136	2157	N/A	INTRINSIC
low complexity region	2247	2260	N/A	INTRINSIC
low complexity region	2485	2499	N/A	INTRINSIC
low complexity region	2665	2682	N/A	INTRINSIC
low complexity region	2887	2899	N/A	INTRINSIC
low complexity region	2952	2964	N/A	INTRINSIC
Pfam:DUF3643	3470	3626	2.1e-71	PFAM
low complexity region	3741	3766	N/A	INTRINSIC
low complexity region	3894	3913	N/A	INTRINSIC
low complexity region	3934	3952	N/A	INTRINSIC
low complexity region	3957	3966	N/A	INTRINSIC
low complexity region	4140	4151	N/A	INTRINSIC
low complexity region	4301	4312	N/A	INTRINSIC
low complexity region	4427	4438	N/A	INTRINSIC
UBCc	4586	4750	1.04e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000182597
AA Change: T4673P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138333
Gene: ENSMUSG00000024073
AA Change: T4673P

Domain	Start	End	E-Value	Type
low complexity region	24	54	N/A	INTRINSIC
BIR	287	363	2.87e-24	SMART
low complexity region	472	493	N/A	INTRINSIC
low complexity region	624	635	N/A	INTRINSIC
low complexity region	674	685	N/A	INTRINSIC
low complexity region	769	781	N/A	INTRINSIC
low complexity region	1054	1071	N/A	INTRINSIC
low complexity region	1369	1380	N/A	INTRINSIC
coiled coil region	1620	1675	N/A	INTRINSIC
low complexity region	1709	1726	N/A	INTRINSIC
low complexity region	1993	1998	N/A	INTRINSIC
low complexity region	2044	2059	N/A	INTRINSIC
low complexity region	2142	2163	N/A	INTRINSIC
low complexity region	2262	2275	N/A	INTRINSIC
low complexity region	2500	2514	N/A	INTRINSIC
low complexity region	2680	2697	N/A	INTRINSIC
low complexity region	2902	2914	N/A	INTRINSIC
low complexity region	2967	2979	N/A	INTRINSIC
Pfam:DUF3643	3485	3641	2.2e-71	PFAM
low complexity region	3756	3781	N/A	INTRINSIC
low complexity region	3909	3928	N/A	INTRINSIC
low complexity region	3949	3967	N/A	INTRINSIC
low complexity region	3972	3981	N/A	INTRINSIC
low complexity region	4155	4166	N/A	INTRINSIC
low complexity region	4316	4327	N/A	INTRINSIC
low complexity region	4442	4453	N/A	INTRINSIC
UBCc	4601	4765	1.04e-25	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182944
AA Change: T4660P

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000138732
Gene: ENSMUSG00000024073
AA Change: T4660P

Domain	Start	End	E-Value	Type
low complexity region	24	54	N/A	INTRINSIC
BIR	287	363	2.87e-24	SMART
low complexity region	472	493	N/A	INTRINSIC
low complexity region	624	635	N/A	INTRINSIC
low complexity region	674	685	N/A	INTRINSIC
low complexity region	769	781	N/A	INTRINSIC
low complexity region	1054	1071	N/A	INTRINSIC
low complexity region	1369	1380	N/A	INTRINSIC
coiled coil region	1616	1671	N/A	INTRINSIC
low complexity region	1705	1722	N/A	INTRINSIC
low complexity region	1989	1994	N/A	INTRINSIC
low complexity region	2040	2055	N/A	INTRINSIC
low complexity region	2138	2159	N/A	INTRINSIC
low complexity region	2249	2262	N/A	INTRINSIC
low complexity region	2487	2501	N/A	INTRINSIC
low complexity region	2667	2684	N/A	INTRINSIC
low complexity region	2889	2901	N/A	INTRINSIC
low complexity region	2954	2966	N/A	INTRINSIC
Pfam:DUF3643	3472	3628	3.2e-71	PFAM
low complexity region	3743	3768	N/A	INTRINSIC
low complexity region	3896	3915	N/A	INTRINSIC
low complexity region	3936	3954	N/A	INTRINSIC
low complexity region	3959	3968	N/A	INTRINSIC
low complexity region	4142	4153	N/A	INTRINSIC
low complexity region	4303	4314	N/A	INTRINSIC
low complexity region	4429	4440	N/A	INTRINSIC
UBCc	4588	4752	1.04e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000183224
AA Change: T4644P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138270
Gene: ENSMUSG00000024073
AA Change: T4644P

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
BIR	259	335	2.87e-24	SMART
low complexity region	444	465	N/A	INTRINSIC
low complexity region	596	607	N/A	INTRINSIC
low complexity region	646	657	N/A	INTRINSIC
low complexity region	741	753	N/A	INTRINSIC
low complexity region	1026	1043	N/A	INTRINSIC
low complexity region	1355	1366	N/A	INTRINSIC
coiled coil region	1606	1661	N/A	INTRINSIC
low complexity region	1695	1712	N/A	INTRINSIC
low complexity region	1979	1984	N/A	INTRINSIC
low complexity region	2030	2041	N/A	INTRINSIC
low complexity region	2122	2143	N/A	INTRINSIC
low complexity region	2233	2246	N/A	INTRINSIC
low complexity region	2471	2485	N/A	INTRINSIC
low complexity region	2651	2668	N/A	INTRINSIC
low complexity region	2873	2885	N/A	INTRINSIC
low complexity region	2938	2950	N/A	INTRINSIC
Pfam:DUF3643	3456	3612	3.2e-71	PFAM
low complexity region	3727	3752	N/A	INTRINSIC
low complexity region	3880	3899	N/A	INTRINSIC
low complexity region	3920	3938	N/A	INTRINSIC
low complexity region	3943	3952	N/A	INTRINSIC
low complexity region	4126	4137	N/A	INTRINSIC
low complexity region	4287	4298	N/A	INTRINSIC
low complexity region	4413	4424	N/A	INTRINSIC
UBCc	4572	4736	1.04e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183249

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a BIR (baculoviral inhibition of apoptosis protein repeat) domain and a UBCc (ubiquitin-conjugating enzyme E2, catalytic) domain. This protein inhibits apoptosis by facilitating the degradation of apoptotic proteins by ubiquitination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit perinatal lethality and exhibit placental defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	A	T	5: 8,939,885	R813*	probably null	Het
Accsl	T	A	2: 93,866,074	I60F	probably benign	Het
Adam29	C	T	8: 55,872,681	G246D	probably benign	Het
Ankrd13c	A	G	3: 157,991,714	I319V	probably benign	Het
B020004J07Rik	T	C	4: 101,836,961	S242G	probably benign	Het
Bag6	T	G	17: 35,141,466	V327G	probably damaging	Het
Barhl1	C	T	2: 28,915,292	A130T	probably benign	Het
Bend4	T	C	5: 67,398,240	D541G	probably damaging	Het
Ccdc81	T	C	7: 89,890,471	R186G	probably damaging	Het
Cdyl2	A	G	8: 116,583,192	F342L	probably damaging	Het
Chd3	C	A	11: 69,357,541	V748L	probably damaging	Het
CN725425	G	T	15: 91,238,944	R72I	possibly damaging	Het
Col22a1	A	G	15: 71,962,671		probably null	Het
Cops3	A	G	11: 59,818,417		probably null	Het
Ctnnd1	G	T	2: 84,603,262	Q940K	possibly damaging	Het
Dtnb	C	T	12: 3,591,971	Q45*	probably null	Het
Efr3a	T	A	15: 65,842,704	I280K	probably damaging	Het
Eml6	A	C	11: 29,893,213	V167G	probably benign	Het
Fam83c	T	A	2: 155,830,295	M407L	probably benign	Het
Fasn	T	C	11: 120,811,068	T1862A	probably benign	Het
Fbxl6	A	G	15: 76,535,955	I486T	probably damaging	Het
Gpr182	A	G	10: 127,750,696	Y129H	probably damaging	Het
Gpr75	A	G	11: 30,892,456	S454G	probably damaging	Het
Hectd4	G	A	5: 121,364,590		probably null	Het
Hsf4	A	G	8: 105,275,590	T411A	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Il4	A	T	11: 53,618,605	M1K	probably null	Het
Ints11	G	T	4: 155,887,948	R463L	probably benign	Het
Ints4	G	A	7: 97,529,223	E677K	probably damaging	Het
Klk1b11	G	A	7: 43,997,792	C50Y	probably damaging	Het
Krt14	C	A	11: 100,207,395	G21C	unknown	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
L3mbtl2	C	T	15: 81,668,741	A125V	probably damaging	Het
Lama3	A	G	18: 12,500,512		probably null	Het
Lrrk2	T	C	15: 91,750,275	L1414P	probably damaging	Het
Matn2	T	C	15: 34,428,541	S684P	probably damaging	Het
Mga	T	A	2: 119,941,381	V1574D	probably damaging	Het
Mia2	T	C	12: 59,172,594		probably null	Het
Mrpl21	T	A	19: 3,292,459		probably benign	Het
Msh5	T	A	17: 35,041,482	Q266L	probably benign	Het
Mybpc1	C	A	10: 88,540,960	C758F	probably damaging	Het
Myo15	G	A	11: 60,509,596	A2932T	possibly damaging	Het
Nbas	T	A	12: 13,519,108	I2021K	probably benign	Het
Neurl4	T	C	11: 69,905,567	S424P	probably damaging	Het
Olfr16	T	A	1: 172,957,398	V201E	probably damaging	Het
Olfr322	A	C	11: 58,665,963	I135L	probably benign	Het
Olfr782	A	G	10: 129,351,234	M224V	probably benign	Het
Olfr829	T	C	9: 18,856,649	M8T	probably benign	Het
Olfr850	T	A	9: 19,478,092	I53F	possibly damaging	Het
Phlpp1	C	T	1: 106,350,578	R907W	probably damaging	Het
Pigg	T	C	5: 108,336,411	V508A	probably benign	Het
Pkhd1l1	T	G	15: 44,501,519	Y685D	probably damaging	Het
Polr3a	A	T	14: 24,484,466	I34N	probably damaging	Het
Prex1	A	G	2: 166,569,377	V1434A	probably benign	Het
Ptprh	T	A	7: 4,598,006	D124V	probably damaging	Het
Rad54b	T	A	4: 11,606,131	I513N	probably benign	Het
Rbm12b1	A	G	4: 12,145,507	N493S	probably benign	Het
Rfx7	A	T	9: 72,610,304		probably null	Het
Serpini1	A	G	3: 75,613,341	K82E	probably benign	Het
Slc27a6	T	G	18: 58,609,165		probably null	Het
Slc35f2	G	T	9: 53,816,917	L358F	probably damaging	Het
Slc45a1	A	C	4: 150,643,305	I158M	probably damaging	Het
Slurp2	G	A	15: 74,743,106	P62L	probably damaging	Het
Sspo	C	T	6: 48,466,740	H1949Y	probably damaging	Het
Tiam1	A	T	16: 89,837,827	V865E	possibly damaging	Het
Tlr4	A	C	4: 66,839,620	I217L	probably damaging	Het
Top1	C	T	2: 160,712,708	R460*	probably null	Het
Trpm3	T	A	19: 22,988,054	S1638T	probably benign	Het
Tubgcp5	C	T	7: 55,823,567	R798C	probably benign	Het
Vars	T	G	17: 35,012,727		probably null	Het
Xylt2	A	G	11: 94,666,333	Y111H	probably benign	Het
Zbed5	G	A	5: 129,901,726	G172D	probably damaging	Het
Zfp53	C	T	17: 21,508,833	T376I	probably benign	Het
Zfp937	G	T	2: 150,239,546	V499L	probably benign	Het
Zyx	T	A	6: 42,351,313	L152Q	probably damaging	Het

Other mutations in Birc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Birc6	APN	17	74573563	splice site	probably benign
IGL00542:Birc6	APN	17	74623771	splice site	probably null
IGL00659:Birc6	APN	17	74660653	missense	probably damaging	1.00
IGL00710:Birc6	APN	17	74609089	missense	probably benign	0.37
IGL00806:Birc6	APN	17	74611529	missense	possibly damaging	0.85
IGL00848:Birc6	APN	17	74696393	nonsense	probably null
IGL01071:Birc6	APN	17	74566132	missense	possibly damaging	0.84
IGL01071:Birc6	APN	17	74631701	missense	probably damaging	1.00
IGL01121:Birc6	APN	17	74631038	missense	probably benign	0.08
IGL01132:Birc6	APN	17	74603060	missense	probably damaging	1.00
IGL01323:Birc6	APN	17	74622925	missense	probably damaging	1.00
IGL01444:Birc6	APN	17	74631687	missense	probably damaging	1.00
IGL01511:Birc6	APN	17	74627003	nonsense	probably null
IGL01576:Birc6	APN	17	74677370	missense	possibly damaging	0.80
IGL01578:Birc6	APN	17	74648197	missense	probably benign	0.08
IGL01649:Birc6	APN	17	74604546	missense	probably benign	0.03
IGL01657:Birc6	APN	17	74660611	missense	probably damaging	1.00
IGL01739:Birc6	APN	17	74659221	missense	probably benign
IGL01756:Birc6	APN	17	74640208	missense	probably benign	0.00
IGL01807:Birc6	APN	17	74631037	missense	probably benign
IGL01885:Birc6	APN	17	74604516	missense	possibly damaging	0.51
IGL01906:Birc6	APN	17	74638358	missense	probably damaging	1.00
IGL01915:Birc6	APN	17	74631720	missense	probably benign	0.34
IGL01998:Birc6	APN	17	74579885	missense	probably benign	0.06
IGL02084:Birc6	APN	17	74608282	missense	probably benign	0.45
IGL02086:Birc6	APN	17	74639827	missense	probably damaging	1.00
IGL02161:Birc6	APN	17	74548837	missense	probably damaging	0.99
IGL02195:Birc6	APN	17	74697381	splice site	probably benign
IGL02283:Birc6	APN	17	74599940	missense	probably benign
IGL02476:Birc6	APN	17	74696391	missense	possibly damaging	0.81
IGL02493:Birc6	APN	17	74652059	unclassified	probably benign
IGL02547:Birc6	APN	17	74579645	missense	probably benign	0.21
IGL02678:Birc6	APN	17	74649903	missense	probably damaging	1.00
IGL02713:Birc6	APN	17	74579324	missense	probably benign
IGL02851:Birc6	APN	17	74609189	missense	probably damaging	1.00
IGL02875:Birc6	APN	17	74589718	missense	probably damaging	1.00
IGL02985:Birc6	APN	17	74640190	missense	probably benign	0.00
IGL03004:Birc6	APN	17	74612185	missense	probably benign	0.10
IGL03053:Birc6	APN	17	74565972	missense	probably damaging	1.00
IGL03085:Birc6	APN	17	74596950	missense	probably damaging	0.97
IGL03109:Birc6	APN	17	74579334	missense	possibly damaging	0.71
IGL03143:Birc6	APN	17	74598999	missense	possibly damaging	0.89
IGL03180:Birc6	APN	17	74659231	missense	probably benign
IGL03221:Birc6	APN	17	74627007	missense	probably benign	0.00
IGL03230:Birc6	APN	17	74611070	missense	probably damaging	1.00
IGL03294:Birc6	APN	17	74649886	missense	probably benign	0.02
IGL03399:Birc6	APN	17	74594373	missense	probably benign	0.01
Badlands	UTSW	17	74603036	missense	probably damaging	1.00
Big_sky	UTSW	17	74528538	missense	probably null	0.33
bitterroot	UTSW	17	74649696	missense	probably damaging	1.00
Black_hills	UTSW	17	74692332	missense	probably damaging	1.00
bottomlands	UTSW	17	74609659	missense	probably damaging	1.00
Chai	UTSW	17	74670374	missense	probably damaging	1.00
Dakota	UTSW	17	74625104	critical splice acceptor site	probably null
Sempervirens	UTSW	17	74642504	missense	probably damaging	1.00
E0370:Birc6	UTSW	17	74677357	missense	probably damaging	1.00
G1citation:Birc6	UTSW	17	74580382	missense	possibly damaging	0.82
G1citation:Birc6	UTSW	17	74598044	missense	probably damaging	1.00
PIT4494001:Birc6	UTSW	17	74626980	missense	probably damaging	1.00
R0081:Birc6	UTSW	17	74643441	missense	probably benign	0.01
R0086:Birc6	UTSW	17	74593166	missense	possibly damaging	0.54
R0089:Birc6	UTSW	17	74638376	missense	possibly damaging	0.90
R0116:Birc6	UTSW	17	74623746	splice site	probably benign
R0129:Birc6	UTSW	17	74528760	missense	probably benign	0.05
R0196:Birc6	UTSW	17	74580287	missense	possibly damaging	0.57
R0201:Birc6	UTSW	17	74609327	missense	possibly damaging	0.92
R0207:Birc6	UTSW	17	74662832	splice site	probably benign
R0295:Birc6	UTSW	17	74613362	intron	probably benign
R0386:Birc6	UTSW	17	74599340	missense	probably damaging	0.99
R0423:Birc6	UTSW	17	74696297	missense	probably damaging	1.00
R0453:Birc6	UTSW	17	74649754	missense	probably damaging	1.00
R0457:Birc6	UTSW	17	74652028	missense	probably benign
R0457:Birc6	UTSW	17	74662625	missense	probably damaging	1.00
R0564:Birc6	UTSW	17	74625243	splice site	probably benign
R0575:Birc6	UTSW	17	74689237	missense	probably damaging	1.00
R0582:Birc6	UTSW	17	74643337	missense	probably damaging	1.00
R0624:Birc6	UTSW	17	74580349	missense	probably benign	0.20
R0973:Birc6	UTSW	17	74565861	missense	probably damaging	0.99
R1061:Birc6	UTSW	17	74689312	missense	probably damaging	1.00
R1378:Birc6	UTSW	17	74660455	missense	probably damaging	1.00
R1402:Birc6	UTSW	17	74697533	splice site	probably benign
R1436:Birc6	UTSW	17	74652705	missense	probably damaging	1.00
R1456:Birc6	UTSW	17	74609290	missense	probably benign	0.35
R1465:Birc6	UTSW	17	74623858	missense	probably benign	0.03
R1465:Birc6	UTSW	17	74623858	missense	probably benign	0.03
R1474:Birc6	UTSW	17	74579678	missense	probably damaging	0.98
R1479:Birc6	UTSW	17	74634853	missense	probably damaging	1.00
R1486:Birc6	UTSW	17	74639820	missense	probably damaging	1.00
R1499:Birc6	UTSW	17	74612319	missense	probably damaging	1.00
R1515:Birc6	UTSW	17	74528636	nonsense	probably null
R1549:Birc6	UTSW	17	74662742	missense	probably damaging	1.00
R1559:Birc6	UTSW	17	74692237	missense	probably damaging	1.00
R1573:Birc6	UTSW	17	74660690	splice site	probably benign
R1615:Birc6	UTSW	17	74609409	splice site	probably null
R1621:Birc6	UTSW	17	74670250	missense	probably benign
R1680:Birc6	UTSW	17	74548746	missense	probably benign	0.01
R1743:Birc6	UTSW	17	74579756	missense	possibly damaging	0.95
R1774:Birc6	UTSW	17	74640013	missense	probably damaging	1.00
R1775:Birc6	UTSW	17	74612286	missense	probably damaging	1.00
R1818:Birc6	UTSW	17	74649849	missense	probably damaging	1.00
R1836:Birc6	UTSW	17	74614390	missense	probably benign	0.41
R1931:Birc6	UTSW	17	74565982	missense	probably damaging	0.99
R1939:Birc6	UTSW	17	74670337	missense	probably damaging	1.00
R1964:Birc6	UTSW	17	74634885	missense	possibly damaging	0.94
R1994:Birc6	UTSW	17	74598062	missense	probably benign	0.01
R2000:Birc6	UTSW	17	74604619	missense	possibly damaging	0.46
R2042:Birc6	UTSW	17	74609659	missense	probably damaging	1.00
R2090:Birc6	UTSW	17	74662796	missense	probably benign
R2130:Birc6	UTSW	17	74659154	splice site	probably benign
R2144:Birc6	UTSW	17	74660413	missense	possibly damaging	0.71
R2145:Birc6	UTSW	17	74660413	missense	possibly damaging	0.71
R2166:Birc6	UTSW	17	74635795	missense	probably benign	0.02
R2180:Birc6	UTSW	17	74612151	missense	probably benign	0.03
R2271:Birc6	UTSW	17	74602971	missense	probably benign	0.06
R2272:Birc6	UTSW	17	74602971	missense	probably benign	0.06
R2416:Birc6	UTSW	17	74608219	missense	possibly damaging	0.83
R2420:Birc6	UTSW	17	74660614	missense	probably damaging	1.00
R2421:Birc6	UTSW	17	74660614	missense	probably damaging	1.00
R2422:Birc6	UTSW	17	74660614	missense	probably damaging	1.00
R2513:Birc6	UTSW	17	74647729	missense	probably damaging	0.97
R2912:Birc6	UTSW	17	74692206	missense	probably damaging	1.00
R3024:Birc6	UTSW	17	74608219	missense	possibly damaging	0.83
R3771:Birc6	UTSW	17	74618429	splice site	probably benign
R3772:Birc6	UTSW	17	74618429	splice site	probably benign
R3829:Birc6	UTSW	17	74655178	missense	probably damaging	1.00
R3913:Birc6	UTSW	17	74573613	nonsense	probably null
R3915:Birc6	UTSW	17	74579608	missense	probably benign	0.12
R3921:Birc6	UTSW	17	74627019	missense	probably damaging	0.98
R3928:Birc6	UTSW	17	74611175	missense	possibly damaging	0.91
R3928:Birc6	UTSW	17	74638409	missense	probably damaging	1.00
R4111:Birc6	UTSW	17	74566015	missense	probably damaging	1.00
R4155:Birc6	UTSW	17	74596939	missense	probably benign	0.00
R4163:Birc6	UTSW	17	74626980	missense	probably damaging	1.00
R4226:Birc6	UTSW	17	74619840	critical splice donor site	probably null
R4227:Birc6	UTSW	17	74619840	critical splice donor site	probably null
R4358:Birc6	UTSW	17	74619668	splice site	probably null
R4524:Birc6	UTSW	17	74641777	missense	probably damaging	1.00
R4605:Birc6	UTSW	17	74639934	missense	probably damaging	1.00
R4619:Birc6	UTSW	17	74640150	missense	probably benign	0.18
R4620:Birc6	UTSW	17	74640150	missense	probably benign	0.18
R4762:Birc6	UTSW	17	74629489	missense	probably damaging	1.00
R4814:Birc6	UTSW	17	74649672	missense	probably damaging	1.00
R4849:Birc6	UTSW	17	74647388	missense	probably damaging	0.99
R4869:Birc6	UTSW	17	74586012	missense	probably benign	0.05
R4912:Birc6	UTSW	17	74565905	missense	probably damaging	1.00
R4921:Birc6	UTSW	17	74650099	missense	probably damaging	1.00
R4942:Birc6	UTSW	17	74623050	missense	probably damaging	1.00
R4954:Birc6	UTSW	17	74612031	missense	probably damaging	1.00
R4992:Birc6	UTSW	17	74689256	missense	probably benign	0.44
R4994:Birc6	UTSW	17	74594324	intron	probably benign
R5018:Birc6	UTSW	17	74640059	missense	probably damaging	1.00
R5022:Birc6	UTSW	17	74692332	missense	probably damaging	1.00
R5054:Birc6	UTSW	17	74655325	missense	probably damaging	1.00
R5068:Birc6	UTSW	17	74565972	missense	probably damaging	1.00
R5069:Birc6	UTSW	17	74565972	missense	probably damaging	1.00
R5070:Birc6	UTSW	17	74565972	missense	probably damaging	1.00
R5196:Birc6	UTSW	17	74606141	splice site	probably benign
R5209:Birc6	UTSW	17	74670374	missense	probably damaging	1.00
R5212:Birc6	UTSW	17	74670374	missense	probably damaging	1.00
R5216:Birc6	UTSW	17	74613470	missense	probably damaging	1.00
R5279:Birc6	UTSW	17	74650047	missense	probably damaging	0.98
R5286:Birc6	UTSW	17	74670247	missense	probably damaging	1.00
R5399:Birc6	UTSW	17	74604578	missense	possibly damaging	0.75
R5482:Birc6	UTSW	17	74641782	missense	possibly damaging	0.86
R5482:Birc6	UTSW	17	74662690	missense	probably damaging	1.00
R5492:Birc6	UTSW	17	74670374	missense	probably damaging	1.00
R5504:Birc6	UTSW	17	74655213	missense	probably damaging	1.00
R5519:Birc6	UTSW	17	74580178	missense	probably benign
R5544:Birc6	UTSW	17	74670374	missense	probably damaging	1.00
R5608:Birc6	UTSW	17	74613544	missense	probably damaging	0.99
R5623:Birc6	UTSW	17	74528656	missense	probably damaging	0.99
R5701:Birc6	UTSW	17	74697425	missense	possibly damaging	0.59
R5707:Birc6	UTSW	17	74696404	missense	probably damaging	1.00
R5715:Birc6	UTSW	17	74631620	missense	probably damaging	1.00
R5734:Birc6	UTSW	17	74618424	splice site	probably benign
R5792:Birc6	UTSW	17	74631053	missense	probably benign	0.05
R5809:Birc6	UTSW	17	74670374	missense	probably damaging	1.00
R5810:Birc6	UTSW	17	74670374	missense	probably damaging	1.00
R5813:Birc6	UTSW	17	74646502	missense	probably damaging	1.00
R5933:Birc6	UTSW	17	74599237	missense	probably damaging	1.00
R5933:Birc6	UTSW	17	74599238	missense	probably damaging	0.98
R5960:Birc6	UTSW	17	74528765	missense	probably damaging	0.97
R5961:Birc6	UTSW	17	74646601	missense	probably damaging	1.00
R5967:Birc6	UTSW	17	74660439	missense	probably damaging	0.99
R5970:Birc6	UTSW	17	74618502	missense	possibly damaging	0.95
R5977:Birc6	UTSW	17	74603036	missense	probably damaging	1.00
R5982:Birc6	UTSW	17	74648158	missense	probably benign
R6023:Birc6	UTSW	17	74654377	missense	probably benign	0.24
R6034:Birc6	UTSW	17	74615283	missense	probably damaging	1.00
R6034:Birc6	UTSW	17	74615283	missense	probably damaging	1.00
R6243:Birc6	UTSW	17	74609387	missense	probably damaging	0.96
R6294:Birc6	UTSW	17	74689257	missense	probably benign	0.00
R6327:Birc6	UTSW	17	74662779	missense	probably damaging	1.00
R6501:Birc6	UTSW	17	74579281	missense	probably damaging	1.00
R6810:Birc6	UTSW	17	74612220	missense	possibly damaging	0.63
R6822:Birc6	UTSW	17	74580382	missense	possibly damaging	0.82
R6822:Birc6	UTSW	17	74598044	missense	probably damaging	1.00
R6835:Birc6	UTSW	17	74642504	missense	probably damaging	1.00
R6945:Birc6	UTSW	17	74579531	missense	probably benign	0.04
R6957:Birc6	UTSW	17	74579491	missense	probably benign
R6989:Birc6	UTSW	17	74630989	missense	probably benign	0.18
R6991:Birc6	UTSW	17	74562095	missense	probably damaging	1.00
R7019:Birc6	UTSW	17	74609345	missense	probably benign	0.01
R7092:Birc6	UTSW	17	74646745	missense	probably damaging	1.00
R7158:Birc6	UTSW	17	74594376	missense	probably benign	0.25
R7204:Birc6	UTSW	17	74640108	missense	probably damaging	1.00
R7267:Birc6	UTSW	17	74585985	missense	probably benign	0.00
R7316:Birc6	UTSW	17	74604494	missense	probably damaging	0.99
R7341:Birc6	UTSW	17	74612074	missense	probably damaging	1.00
R7404:Birc6	UTSW	17	74639794	missense	possibly damaging	0.73
R7449:Birc6	UTSW	17	74702341	missense	probably benign
R7498:Birc6	UTSW	17	74660470	missense	probably damaging	1.00
R7539:Birc6	UTSW	17	74649696	missense	probably damaging	1.00
R7569:Birc6	UTSW	17	74598082	missense	possibly damaging	0.71
R7574:Birc6	UTSW	17	74579884	missense	probably benign
R7611:Birc6	UTSW	17	74662718	missense	probably damaging	0.98
R7653:Birc6	UTSW	17	74647734	missense	possibly damaging	0.91
R7716:Birc6	UTSW	17	74562061	missense	probably damaging	0.99
R7728:Birc6	UTSW	17	74622105	missense	probably benign	0.01
R7810:Birc6	UTSW	17	74548820	missense	probably damaging	0.98
R7828:Birc6	UTSW	17	74579506	missense	probably damaging	0.97
R7881:Birc6	UTSW	17	74641671	missense	probably damaging	0.99
R7896:Birc6	UTSW	17	74622082	missense	probably damaging	0.99
R7950:Birc6	UTSW	17	74593100	missense	probably damaging	1.00
R7988:Birc6	UTSW	17	74599373	splice site	probably null
R8073:Birc6	UTSW	17	74603085	missense	probably damaging	1.00
R8128:Birc6	UTSW	17	74609258	missense	probably damaging	1.00
R8167:Birc6	UTSW	17	74643394	missense	probably damaging	1.00
R8236:Birc6	UTSW	17	74611131	missense	probably damaging	1.00
R8237:Birc6	UTSW	17	74611131	missense	probably damaging	1.00
R8255:Birc6	UTSW	17	74662780	missense	probably damaging	0.99
R8259:Birc6	UTSW	17	74598078	missense	probably benign	0.01
R8297:Birc6	UTSW	17	74625104	critical splice acceptor site	probably null
R8376:Birc6	UTSW	17	74589640	missense	probably benign	0.18
R8413:Birc6	UTSW	17	74546393	missense	possibly damaging	0.54
R8503:Birc6	UTSW	17	74692244	missense	probably damaging	1.00
R8504:Birc6	UTSW	17	74652005	missense	probably damaging	0.98
R8543:Birc6	UTSW	17	74565865	missense	probably damaging	1.00
R8550:Birc6	UTSW	17	74557954	missense	probably benign	0.37
R8551:Birc6	UTSW	17	74557954	missense	probably benign	0.37
R8556:Birc6	UTSW	17	74557954	missense	probably benign	0.37
R8683:Birc6	UTSW	17	74609119	missense	possibly damaging	0.74
R8751:Birc6	UTSW	17	74648140	missense	probably damaging	0.98
R8803:Birc6	UTSW	17	74652038	missense	probably damaging	0.99
R8806:Birc6	UTSW	17	74642316	missense	probably damaging	1.00
R8825:Birc6	UTSW	17	74613505	missense	probably damaging	0.99
R8888:Birc6	UTSW	17	74528538	missense	probably null	0.33
R8972:Birc6	UTSW	17	74702318	missense	probably benign	0.05
R9069:Birc6	UTSW	17	74561265	splice site	probably benign
R9111:Birc6	UTSW	17	74659345	missense	probably damaging	0.99
R9130:Birc6	UTSW	17	74612151	missense
R9352:Birc6	UTSW	17	74658352	critical splice donor site	probably null
R9354:Birc6	UTSW	17	74614406	missense	probably benign
R9432:Birc6	UTSW	17	74659221	missense	probably benign
R9446:Birc6	UTSW	17	74618496	missense	probably damaging	1.00
R9485:Birc6	UTSW	17	74638403	missense	probably damaging	1.00
R9499:Birc6	UTSW	17	74609069	missense	probably benign	0.05
R9551:Birc6	UTSW	17	74609069	missense	probably benign	0.05
R9552:Birc6	UTSW	17	74609069	missense	probably benign	0.05
R9585:Birc6	UTSW	17	74609270	missense	probably damaging	1.00
R9647:Birc6	UTSW	17	74692310	missense	probably damaging	1.00
R9648:Birc6	UTSW	17	74631701	missense	probably damaging	1.00
R9667:Birc6	UTSW	17	74697425	missense	possibly damaging	0.59
R9696:Birc6	UTSW	17	74640297	missense	probably damaging	0.99
RF016:Birc6	UTSW	17	74689324	missense	probably damaging	1.00
Z1088:Birc6	UTSW	17	74611542	missense	probably damaging	0.99
Z1177:Birc6	UTSW	17	74647280	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- GTTCTCTAAGATGCTCCTGCGGATG -3'
(R):5'- TGTGGAAGCTCTTGTTTCGCCC -3'

Sequencing Primer
(F):5'- GCGGATGATTCTCACAGATCTC -3'
(R):5'- TTCTCTCCTATTTTCAAAGTGATCTG -3'

Posted On

2013-05-23