Incidental Mutation 'R5165:Shank2'
ID395651
Institutional Source Beutler Lab
Gene Symbol Shank2
Ensembl Gene ENSMUSG00000037541
Gene NameSH3 and multiple ankyrin repeat domains 2
SynonymsProSAP1
MMRRC Submission 042746-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5165 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location144001928-144424494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144409636 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 327 (V327D)
Ref Sequence ENSEMBL: ENSMUSP00000146440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097929] [ENSMUST00000105900] [ENSMUST00000105902] [ENSMUST00000146006]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097929
AA Change: V320D

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095542
Gene: ENSMUSG00000037541
AA Change: V320D

DomainStartEndE-ValueType
PDZ 46 131 1.75e-14 SMART
low complexity region 135 154 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 570 582 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 814 828 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 915 937 N/A INTRINSIC
low complexity region 951 967 N/A INTRINSIC
low complexity region 989 997 N/A INTRINSIC
low complexity region 1077 1091 N/A INTRINSIC
low complexity region 1134 1149 N/A INTRINSIC
low complexity region 1173 1187 N/A INTRINSIC
SAM 1196 1262 2.52e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105900
AA Change: V537D

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101520
Gene: ENSMUSG00000037541
AA Change: V537D

DomainStartEndE-ValueType
SH3 150 205 1.04e-14 SMART
PDZ 256 341 1.75e-14 SMART
low complexity region 345 364 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
low complexity region 662 674 N/A INTRINSIC
low complexity region 749 760 N/A INTRINSIC
low complexity region 780 792 N/A INTRINSIC
low complexity region 829 847 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
low complexity region 1125 1147 N/A INTRINSIC
low complexity region 1161 1177 N/A INTRINSIC
low complexity region 1199 1207 N/A INTRINSIC
low complexity region 1287 1301 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
SAM 1406 1472 2.52e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105902
AA Change: V906D

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: V906D

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:FERM_f0 57 140 1.4e-21 PFAM
ANK 196 226 1.4e1 SMART
ANK 230 259 2.77e-3 SMART
ANK 263 293 1.42e0 SMART
ANK 297 326 1.25e-1 SMART
ANK 330 359 7.83e-3 SMART
ANK 363 391 1.29e2 SMART
SH3 529 584 1.04e-14 SMART
PDZ 635 720 1.75e-14 SMART
low complexity region 724 743 N/A INTRINSIC
low complexity region 878 893 N/A INTRINSIC
low complexity region 1031 1043 N/A INTRINSIC
low complexity region 1118 1129 N/A INTRINSIC
low complexity region 1149 1161 N/A INTRINSIC
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1462 1473 N/A INTRINSIC
low complexity region 1494 1516 N/A INTRINSIC
low complexity region 1530 1546 N/A INTRINSIC
low complexity region 1568 1576 N/A INTRINSIC
low complexity region 1656 1670 N/A INTRINSIC
low complexity region 1713 1728 N/A INTRINSIC
low complexity region 1752 1766 N/A INTRINSIC
SAM 1775 1841 2.52e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125355
Predicted Effect possibly damaging
Transcript: ENSMUST00000146006
AA Change: V327D

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.0871 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 T A 6: 83,526,832 I77F probably benign Het
Actl6a G A 3: 32,720,208 V285I probably benign Het
Adam9 A T 8: 24,967,174 I646N possibly damaging Het
Ahnak T C 19: 9,015,665 I4771T possibly damaging Het
Alas1 T C 9: 106,241,255 T223A probably damaging Het
Apc2 A G 10: 80,315,850 E2246G probably damaging Het
Atp1a1 A G 3: 101,581,789 I795T probably benign Het
Cdhr4 T C 9: 107,997,630 L633P probably damaging Het
Cep350 A G 1: 155,928,368 S990P probably damaging Het
Cplx2 A G 13: 54,378,976 I66V possibly damaging Het
Cx3cl1 T C 8: 94,779,876 S170P probably benign Het
Cyth1 T C 11: 118,169,082 N353S possibly damaging Het
Dapp1 T C 3: 137,939,215 probably null Het
Dmwd G A 7: 19,078,035 probably benign Het
Dsg1c A G 18: 20,277,023 H516R probably damaging Het
Efemp2 T C 19: 5,475,411 C39R probably damaging Het
Fnbp4 C G 2: 90,777,657 Q908E possibly damaging Het
Foxred2 A G 15: 77,956,012 V26A probably damaging Het
Gkap1 A G 13: 58,263,196 probably null Het
Gstcd A C 3: 133,084,679 V109G probably damaging Het
Hoxc9 T A 15: 102,984,000 M215K probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnj9 A T 1: 172,323,157 D296E probably benign Het
Kctd18 T C 1: 57,959,236 Y68C probably damaging Het
Kif21a A T 15: 90,956,376 M1179K probably benign Het
Lrfn5 T C 12: 61,839,624 I66T possibly damaging Het
Lrp12 A G 15: 39,872,461 S692P probably benign Het
Lrrc10 A T 10: 117,046,060 N213I probably benign Het
Mettl11b A G 1: 163,722,523 I53T probably benign Het
Nceh1 G A 3: 27,241,528 V313I probably benign Het
Nkx6-3 T A 8: 23,153,743 H53Q probably damaging Het
Nov A G 15: 54,749,189 D198G probably damaging Het
Olfr1276 T A 2: 111,257,223 V36E possibly damaging Het
Olfr128 A G 17: 37,924,361 D265G probably benign Het
Olfr1388 A G 11: 49,444,376 H175R probably damaging Het
Olfr1447 A T 19: 12,901,200 N193K probably benign Het
Oxct1 A T 15: 4,053,769 T157S possibly damaging Het
Pcdhga3 A G 18: 37,675,670 E392G possibly damaging Het
Polr1a T G 6: 71,967,925 Y1322D probably damaging Het
Prkdc T A 16: 15,678,272 S776T probably damaging Het
Ralgapb A G 2: 158,465,912 I1047V possibly damaging Het
Sertad4 A T 1: 192,846,822 S229T possibly damaging Het
Skint6 A T 4: 112,865,668 V904E possibly damaging Het
Slfn8 A T 11: 83,017,127 Y197N probably damaging Het
Smo T A 6: 29,736,078 L23Q unknown Het
Snx29 T A 16: 11,420,775 M23K probably damaging Het
Synrg T C 11: 83,990,935 S366P probably benign Het
Tomm40 A G 7: 19,713,667 probably null Het
Tpcn1 T C 5: 120,557,945 E81G probably damaging Het
Trappc1 A G 11: 69,324,234 Q26R probably benign Het
Ttn T A 2: 76,776,556 probably null Het
Usp25 T A 16: 77,076,405 D450E possibly damaging Het
Zmynd19 T A 2: 24,958,189 Y132* probably null Het
Other mutations in Shank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Shank2 APN 7 144411847 missense probably damaging 1.00
IGL00516:Shank2 APN 7 144410775 missense possibly damaging 0.96
IGL00919:Shank2 APN 7 144411271 missense probably damaging 0.97
IGL01450:Shank2 APN 7 144285068 nonsense probably null
IGL01996:Shank2 APN 7 144411493 missense probably damaging 1.00
IGL02217:Shank2 APN 7 144285047 missense possibly damaging 0.59
IGL02314:Shank2 APN 7 144411271 missense probably benign 0.01
IGL02320:Shank2 APN 7 144420944 missense probably damaging 1.00
IGL02948:Shank2 APN 7 144409636 missense probably benign 0.03
IGL02997:Shank2 APN 7 144081873 missense probably benign 0.16
R0077:Shank2 UTSW 7 144192467 missense possibly damaging 0.85
R0109:Shank2 UTSW 7 144410577 missense possibly damaging 0.81
R0126:Shank2 UTSW 7 144031355 missense probably damaging 0.99
R0153:Shank2 UTSW 7 144070135 missense probably benign 0.04
R0644:Shank2 UTSW 7 144411849 missense probably benign
R1072:Shank2 UTSW 7 144411568 missense probably damaging 1.00
R1245:Shank2 UTSW 7 144411720 missense probably benign 0.00
R1424:Shank2 UTSW 7 144052372 missense probably damaging 0.99
R1712:Shank2 UTSW 7 144411153 missense probably damaging 1.00
R1739:Shank2 UTSW 7 144179853 missense probably damaging 1.00
R1791:Shank2 UTSW 7 144410599 missense probably damaging 1.00
R1889:Shank2 UTSW 7 144186858 nonsense probably null
R2074:Shank2 UTSW 7 144409540 missense probably damaging 1.00
R2135:Shank2 UTSW 7 144411234 missense probably damaging 0.99
R2355:Shank2 UTSW 7 144057718 missense possibly damaging 0.94
R2511:Shank2 UTSW 7 144411577 missense probably damaging 1.00
R2517:Shank2 UTSW 7 144052305 missense possibly damaging 0.89
R2570:Shank2 UTSW 7 144068770 missense probably damaging 1.00
R2846:Shank2 UTSW 7 144070055 missense probably damaging 1.00
R3159:Shank2 UTSW 7 144081874 missense probably damaging 0.98
R3881:Shank2 UTSW 7 144405384 missense probably benign
R3907:Shank2 UTSW 7 144409576 missense probably damaging 1.00
R3938:Shank2 UTSW 7 144128375 missense probably benign 0.20
R4151:Shank2 UTSW 7 144054828 missense probably damaging 1.00
R4369:Shank2 UTSW 7 144179781 missense probably damaging 0.99
R4372:Shank2 UTSW 7 144410862 missense probably benign 0.09
R4519:Shank2 UTSW 7 144410205 missense probably damaging 1.00
R4627:Shank2 UTSW 7 144411424 missense probably damaging 1.00
R4645:Shank2 UTSW 7 144410422 missense possibly damaging 0.65
R4647:Shank2 UTSW 7 144411829 missense probably damaging 1.00
R4689:Shank2 UTSW 7 144420605 missense probably benign 0.07
R4751:Shank2 UTSW 7 144409468 missense probably damaging 1.00
R4816:Shank2 UTSW 7 144052306 missense probably damaging 1.00
R4843:Shank2 UTSW 7 144031409 missense probably benign 0.17
R4929:Shank2 UTSW 7 144411271 missense probably benign 0.01
R5009:Shank2 UTSW 7 144070179 missense probably benign 0.00
R5027:Shank2 UTSW 7 144259105 nonsense probably null
R5278:Shank2 UTSW 7 144068875 critical splice donor site probably null
R5332:Shank2 UTSW 7 144411292 missense possibly damaging 0.82
R5497:Shank2 UTSW 7 144409534 missense probably damaging 1.00
R5525:Shank2 UTSW 7 144070109 missense probably damaging 1.00
R5575:Shank2 UTSW 7 144410134 missense probably damaging 1.00
R5948:Shank2 UTSW 7 144407223 missense probably damaging 0.98
R6024:Shank2 UTSW 7 144180031 missense probably benign 0.12
R6306:Shank2 UTSW 7 144409680 missense probably benign 0.00
R6317:Shank2 UTSW 7 144285084 missense possibly damaging 0.89
R6358:Shank2 UTSW 7 144031297 missense probably benign 0.25
R6364:Shank2 UTSW 7 144410409 missense probably benign 0.14
R6413:Shank2 UTSW 7 144410218 missense probably damaging 1.00
R6680:Shank2 UTSW 7 144420866 missense probably damaging 1.00
R6834:Shank2 UTSW 7 144409894 missense probably damaging 1.00
R6870:Shank2 UTSW 7 144052460 missense probably damaging 0.99
R6933:Shank2 UTSW 7 144091778 missense probably benign 0.19
R6983:Shank2 UTSW 7 144081848 missense possibly damaging 0.94
R7082:Shank2 UTSW 7 144410359 missense probably damaging 0.99
R7100:Shank2 UTSW 7 144411164 missense possibly damaging 0.73
R7111:Shank2 UTSW 7 144411552 missense probably benign 0.00
R7213:Shank2 UTSW 7 144031409 missense probably benign 0.17
R7225:Shank2 UTSW 7 144285025 missense probably benign 0.42
R7325:Shank2 UTSW 7 144411685 missense probably benign 0.04
R7605:Shank2 UTSW 7 144091779 missense possibly damaging 0.64
R7909:Shank2 UTSW 7 144411394 missense probably damaging 1.00
R7976:Shank2 UTSW 7 144411061 missense probably damaging 0.99
R8118:Shank2 UTSW 7 144409875 missense probably benign 0.01
RF009:Shank2 UTSW 7 144411571 missense possibly damaging 0.81
Z1176:Shank2 UTSW 7 144128377 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTGCTTGCAGGGATAACAGAG -3'
(R):5'- TACGGGTTCTCAGGCATCTG -3'

Sequencing Primer
(F):5'- GGAAGAGCGGCAGTTTCTG -3'
(R):5'- AGGCATCTGTCCCCGCTTG -3'
Posted On2016-06-21