Incidental Mutation 'R5165:Adam9'
ID395653
Institutional Source Beutler Lab
Gene Symbol Adam9
Ensembl Gene ENSMUSG00000031555
Gene Namea disintegrin and metallopeptidase domain 9 (meltrin gamma)
SynonymsMDC9, MDC9, Mltng, Mltng
MMRRC Submission 042746-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5165 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location24949611-25016927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24967174 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 646 (I646N)
Ref Sequence ENSEMBL: ENSMUSP00000081045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084032] [ENSMUST00000084035] [ENSMUST00000208247]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084032
AA Change: I646N

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081045
Gene: ENSMUSG00000031555
AA Change: I646N

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 163 8.5e-36 PFAM
Pfam:Reprolysin_5 210 386 5.5e-20 PFAM
Pfam:Reprolysin_4 210 402 1.4e-11 PFAM
Pfam:Reprolysin 212 406 1e-67 PFAM
Pfam:Reprolysin_2 232 396 1.1e-12 PFAM
Pfam:Reprolysin_3 236 358 8.1e-19 PFAM
DISIN 423 499 8.7e-44 SMART
ACR 500 637 9.7e-75 SMART
EGF 643 674 9.9e-2 SMART
transmembrane domain 699 718 N/A INTRINSIC
low complexity region 753 787 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084035
AA Change: I646N

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081048
Gene: ENSMUSG00000031555
AA Change: I646N

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 163 8.1e-31 PFAM
Pfam:Reprolysin_5 210 386 5.8e-22 PFAM
Pfam:Reprolysin_4 210 402 1.6e-13 PFAM
Pfam:Reprolysin 212 406 1.9e-73 PFAM
Pfam:Reprolysin_2 232 396 9.4e-15 PFAM
Pfam:Reprolysin_3 236 358 3.4e-19 PFAM
DISIN 423 499 1.71e-41 SMART
ACR 500 637 2.86e-72 SMART
EGF 643 674 2.03e1 SMART
transmembrane domain 699 718 N/A INTRINSIC
low complexity region 753 794 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 831 839 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208247
AA Change: I646N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene interacts with SH3 domain-containing proteins, binds mitotic arrest deficient 2 beta protein, and is also involved in TPA-induced ectodomain shedding of membrane-anchored heparin-binding EGF-like growth factor. Several alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous knockout mice exhibit progressive retinal degeneration, disorganized retinal layers and a degenerate retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 T A 6: 83,526,832 I77F probably benign Het
Actl6a G A 3: 32,720,208 V285I probably benign Het
Ahnak T C 19: 9,015,665 I4771T possibly damaging Het
Alas1 T C 9: 106,241,255 T223A probably damaging Het
Apc2 A G 10: 80,315,850 E2246G probably damaging Het
Atp1a1 A G 3: 101,581,789 I795T probably benign Het
Cdhr4 T C 9: 107,997,630 L633P probably damaging Het
Cep350 A G 1: 155,928,368 S990P probably damaging Het
Cplx2 A G 13: 54,378,976 I66V possibly damaging Het
Cx3cl1 T C 8: 94,779,876 S170P probably benign Het
Cyth1 T C 11: 118,169,082 N353S possibly damaging Het
Dapp1 T C 3: 137,939,215 probably null Het
Dmwd G A 7: 19,078,035 probably benign Het
Dsg1c A G 18: 20,277,023 H516R probably damaging Het
Efemp2 T C 19: 5,475,411 C39R probably damaging Het
Fnbp4 C G 2: 90,777,657 Q908E possibly damaging Het
Foxred2 A G 15: 77,956,012 V26A probably damaging Het
Gkap1 A G 13: 58,263,196 probably null Het
Gstcd A C 3: 133,084,679 V109G probably damaging Het
Hoxc9 T A 15: 102,984,000 M215K probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnj9 A T 1: 172,323,157 D296E probably benign Het
Kctd18 T C 1: 57,959,236 Y68C probably damaging Het
Kif21a A T 15: 90,956,376 M1179K probably benign Het
Lrfn5 T C 12: 61,839,624 I66T possibly damaging Het
Lrp12 A G 15: 39,872,461 S692P probably benign Het
Lrrc10 A T 10: 117,046,060 N213I probably benign Het
Mettl11b A G 1: 163,722,523 I53T probably benign Het
Nceh1 G A 3: 27,241,528 V313I probably benign Het
Nkx6-3 T A 8: 23,153,743 H53Q probably damaging Het
Nov A G 15: 54,749,189 D198G probably damaging Het
Olfr1276 T A 2: 111,257,223 V36E possibly damaging Het
Olfr128 A G 17: 37,924,361 D265G probably benign Het
Olfr1388 A G 11: 49,444,376 H175R probably damaging Het
Olfr1447 A T 19: 12,901,200 N193K probably benign Het
Oxct1 A T 15: 4,053,769 T157S possibly damaging Het
Pcdhga3 A G 18: 37,675,670 E392G possibly damaging Het
Polr1a T G 6: 71,967,925 Y1322D probably damaging Het
Prkdc T A 16: 15,678,272 S776T probably damaging Het
Ralgapb A G 2: 158,465,912 I1047V possibly damaging Het
Sertad4 A T 1: 192,846,822 S229T possibly damaging Het
Shank2 T A 7: 144,409,636 V327D possibly damaging Het
Skint6 A T 4: 112,865,668 V904E possibly damaging Het
Slfn8 A T 11: 83,017,127 Y197N probably damaging Het
Smo T A 6: 29,736,078 L23Q unknown Het
Snx29 T A 16: 11,420,775 M23K probably damaging Het
Synrg T C 11: 83,990,935 S366P probably benign Het
Tomm40 A G 7: 19,713,667 probably null Het
Tpcn1 T C 5: 120,557,945 E81G probably damaging Het
Trappc1 A G 11: 69,324,234 Q26R probably benign Het
Ttn T A 2: 76,776,556 probably null Het
Usp25 T A 16: 77,076,405 D450E possibly damaging Het
Zmynd19 T A 2: 24,958,189 Y132* probably null Het
Other mutations in Adam9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01611:Adam9 APN 8 24967196 missense probably benign 0.03
IGL01786:Adam9 APN 8 24996839 missense probably damaging 1.00
IGL02095:Adam9 APN 8 24996729 missense probably benign 0.00
IGL02322:Adam9 APN 8 24955974 missense probably damaging 1.00
IGL02555:Adam9 APN 8 24966736 missense probably damaging 1.00
IGL02869:Adam9 APN 8 24970618 missense probably damaging 1.00
R0126:Adam9 UTSW 8 24970737 missense probably damaging 1.00
R0448:Adam9 UTSW 8 24964910 missense probably damaging 1.00
R0552:Adam9 UTSW 8 24963010 missense probably benign 0.00
R0730:Adam9 UTSW 8 24996758 missense probably benign 0.02
R1455:Adam9 UTSW 8 24993109 missense probably benign 0.00
R1974:Adam9 UTSW 8 24992224 missense probably damaging 1.00
R2043:Adam9 UTSW 8 24996653 critical splice donor site probably null
R2054:Adam9 UTSW 8 24991294 missense probably damaging 1.00
R2091:Adam9 UTSW 8 24995184 splice site probably benign
R2111:Adam9 UTSW 8 24982126 splice site probably benign
R4261:Adam9 UTSW 8 24964907 nonsense probably null
R4852:Adam9 UTSW 8 25003301 missense probably damaging 1.00
R6022:Adam9 UTSW 8 25003305 missense possibly damaging 0.87
R6101:Adam9 UTSW 8 24970759 missense probably damaging 1.00
R6105:Adam9 UTSW 8 24970759 missense probably damaging 1.00
R6415:Adam9 UTSW 8 24978482 missense probably damaging 1.00
R7241:Adam9 UTSW 8 24950986 missense possibly damaging 0.53
R7442:Adam9 UTSW 8 24967207 missense probably damaging 0.99
R7552:Adam9 UTSW 8 24955972 missense unknown
R8076:Adam9 UTSW 8 24962922 nonsense probably null
R8265:Adam9 UTSW 8 24967186 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATTAAGTGTGGAACAGGTCTG -3'
(R):5'- CCAATGCTCAGAAGTCTTGC -3'

Sequencing Primer
(F):5'- GTCTGGGGGTAAATGAAATATCTACC -3'
(R):5'- GATCTTTTTAATGTCTCCAGCTT -3'
Posted On2016-06-21