Mutagenetix > Incidental Mutations

Incidental Mutation 'R5165:Adam9'

395653

Institutional Source

Beutler Lab

Gene Symbol

Adam9

Ensembl Gene

ENSMUSG00000031555

Gene Name

a disintegrin and metallopeptidase domain 9 (meltrin gamma)

Synonyms

MDC9, MDC9, Mltng, Mltng

MMRRC Submission

042746-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5165 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24949611-25016927 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 24967174 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 646 (I646N)

Ref Sequence

ENSEMBL: ENSMUSP00000081045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084032] [ENSMUST00000084035] [ENSMUST00000208247]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084032
AA Change: I646N

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000081045
Gene: ENSMUSG00000031555
AA Change: I646N

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	163	8.5e-36	PFAM
Pfam:Reprolysin_5	210	386	5.5e-20	PFAM
Pfam:Reprolysin_4	210	402	1.4e-11	PFAM
Pfam:Reprolysin	212	406	1e-67	PFAM
Pfam:Reprolysin_2	232	396	1.1e-12	PFAM
Pfam:Reprolysin_3	236	358	8.1e-19	PFAM
DISIN	423	499	8.7e-44	SMART
ACR	500	637	9.7e-75	SMART
EGF	643	674	9.9e-2	SMART
transmembrane domain	699	718	N/A	INTRINSIC
low complexity region	753	787	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084035
AA Change: I646N

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000081048
Gene: ENSMUSG00000031555
AA Change: I646N

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Pep_M12B_propep	34	163	8.1e-31	PFAM
Pfam:Reprolysin_5	210	386	5.8e-22	PFAM
Pfam:Reprolysin_4	210	402	1.6e-13	PFAM
Pfam:Reprolysin	212	406	1.9e-73	PFAM
Pfam:Reprolysin_2	232	396	9.4e-15	PFAM
Pfam:Reprolysin_3	236	358	3.4e-19	PFAM
DISIN	423	499	1.71e-41	SMART
ACR	500	637	2.86e-72	SMART
EGF	643	674	2.03e1	SMART
transmembrane domain	699	718	N/A	INTRINSIC
low complexity region	753	794	N/A	INTRINSIC
low complexity region	808	826	N/A	INTRINSIC
low complexity region	831	839	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208247
AA Change: I646N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene interacts with SH3 domain-containing proteins, binds mitotic arrest deficient 2 beta protein, and is also involved in TPA-induced ectodomain shedding of membrane-anchored heparin-binding EGF-like growth factor. Several alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous knockout mice exhibit progressive retinal degeneration, disorganized retinal layers and a degenerate retinal pigment epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actg2	T	A	6: 83,526,832	I77F	probably benign	Het
Actl6a	G	A	3: 32,720,208	V285I	probably benign	Het
Ahnak	T	C	19: 9,015,665	I4771T	possibly damaging	Het
Alas1	T	C	9: 106,241,255	T223A	probably damaging	Het
Apc2	A	G	10: 80,315,850	E2246G	probably damaging	Het
Atp1a1	A	G	3: 101,581,789	I795T	probably benign	Het
Cdhr4	T	C	9: 107,997,630	L633P	probably damaging	Het
Cep350	A	G	1: 155,928,368	S990P	probably damaging	Het
Cplx2	A	G	13: 54,378,976	I66V	possibly damaging	Het
Cx3cl1	T	C	8: 94,779,876	S170P	probably benign	Het
Cyth1	T	C	11: 118,169,082	N353S	possibly damaging	Het
Dapp1	T	C	3: 137,939,215		probably null	Het
Dmwd	G	A	7: 19,078,035		probably benign	Het
Dsg1c	A	G	18: 20,277,023	H516R	probably damaging	Het
Efemp2	T	C	19: 5,475,411	C39R	probably damaging	Het
Fnbp4	C	G	2: 90,777,657	Q908E	possibly damaging	Het
Foxred2	A	G	15: 77,956,012	V26A	probably damaging	Het
Gkap1	A	G	13: 58,263,196		probably null	Het
Gstcd	A	C	3: 133,084,679	V109G	probably damaging	Het
Hoxc9	T	A	15: 102,984,000	M215K	probably damaging	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Kcnj9	A	T	1: 172,323,157	D296E	probably benign	Het
Kctd18	T	C	1: 57,959,236	Y68C	probably damaging	Het
Kif21a	A	T	15: 90,956,376	M1179K	probably benign	Het
Lrfn5	T	C	12: 61,839,624	I66T	possibly damaging	Het
Lrp12	A	G	15: 39,872,461	S692P	probably benign	Het
Lrrc10	A	T	10: 117,046,060	N213I	probably benign	Het
Mettl11b	A	G	1: 163,722,523	I53T	probably benign	Het
Nceh1	G	A	3: 27,241,528	V313I	probably benign	Het
Nkx6-3	T	A	8: 23,153,743	H53Q	probably damaging	Het
Nov	A	G	15: 54,749,189	D198G	probably damaging	Het
Olfr1276	T	A	2: 111,257,223	V36E	possibly damaging	Het
Olfr128	A	G	17: 37,924,361	D265G	probably benign	Het
Olfr1388	A	G	11: 49,444,376	H175R	probably damaging	Het
Olfr1447	A	T	19: 12,901,200	N193K	probably benign	Het
Oxct1	A	T	15: 4,053,769	T157S	possibly damaging	Het
Pcdhga3	A	G	18: 37,675,670	E392G	possibly damaging	Het
Polr1a	T	G	6: 71,967,925	Y1322D	probably damaging	Het
Prkdc	T	A	16: 15,678,272	S776T	probably damaging	Het
Ralgapb	A	G	2: 158,465,912	I1047V	possibly damaging	Het
Sertad4	A	T	1: 192,846,822	S229T	possibly damaging	Het
Shank2	T	A	7: 144,409,636	V327D	possibly damaging	Het
Skint6	A	T	4: 112,865,668	V904E	possibly damaging	Het
Slfn8	A	T	11: 83,017,127	Y197N	probably damaging	Het
Smo	T	A	6: 29,736,078	L23Q	unknown	Het
Snx29	T	A	16: 11,420,775	M23K	probably damaging	Het
Synrg	T	C	11: 83,990,935	S366P	probably benign	Het
Tomm40	A	G	7: 19,713,667		probably null	Het
Tpcn1	T	C	5: 120,557,945	E81G	probably damaging	Het
Trappc1	A	G	11: 69,324,234	Q26R	probably benign	Het
Ttn	T	A	2: 76,776,556		probably null	Het
Usp25	T	A	16: 77,076,405	D450E	possibly damaging	Het
Zmynd19	T	A	2: 24,958,189	Y132*	probably null	Het

Other mutations in Adam9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01611:Adam9	APN	8	24967196	missense	probably benign	0.03
IGL01786:Adam9	APN	8	24996839	missense	probably damaging	1.00
IGL02095:Adam9	APN	8	24996729	missense	probably benign	0.00
IGL02322:Adam9	APN	8	24955974	missense	probably damaging	1.00
IGL02555:Adam9	APN	8	24966736	missense	probably damaging	1.00
IGL02869:Adam9	APN	8	24970618	missense	probably damaging	1.00
R0126:Adam9	UTSW	8	24970737	missense	probably damaging	1.00
R0448:Adam9	UTSW	8	24964910	missense	probably damaging	1.00
R0552:Adam9	UTSW	8	24963010	missense	probably benign	0.00
R0730:Adam9	UTSW	8	24996758	missense	probably benign	0.02
R1455:Adam9	UTSW	8	24993109	missense	probably benign	0.00
R1974:Adam9	UTSW	8	24992224	missense	probably damaging	1.00
R2043:Adam9	UTSW	8	24996653	critical splice donor site	probably null
R2054:Adam9	UTSW	8	24991294	missense	probably damaging	1.00
R2091:Adam9	UTSW	8	24995184	splice site	probably benign
R2111:Adam9	UTSW	8	24982126	splice site	probably benign
R4261:Adam9	UTSW	8	24964907	nonsense	probably null
R4852:Adam9	UTSW	8	25003301	missense	probably damaging	1.00
R6022:Adam9	UTSW	8	25003305	missense	possibly damaging	0.87
R6101:Adam9	UTSW	8	24970759	missense	probably damaging	1.00
R6105:Adam9	UTSW	8	24970759	missense	probably damaging	1.00
R6415:Adam9	UTSW	8	24978482	missense	probably damaging	1.00
R7241:Adam9	UTSW	8	24950986	missense	possibly damaging	0.53
R7442:Adam9	UTSW	8	24967207	missense	probably damaging	0.99
R7552:Adam9	UTSW	8	24955972	missense	unknown
R8076:Adam9	UTSW	8	24962922	nonsense	probably null
R8265:Adam9	UTSW	8	24967186	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAATTAAGTGTGGAACAGGTCTG -3'
(R):5'- CCAATGCTCAGAAGTCTTGC -3'

Sequencing Primer
(F):5'- GTCTGGGGGTAAATGAAATATCTACC -3'
(R):5'- GATCTTTTTAATGTCTCCAGCTT -3'

Posted On

2016-06-21