Incidental Mutation 'R5165:Gkap1'
ID395666
Institutional Source Beutler Lab
Gene Symbol Gkap1
Ensembl Gene ENSMUSG00000021552
Gene NameG kinase anchoring protein 1
SynonymsGkap42, 42kDa, D13Ertd340e, 4933400B15Rik
MMRRC Submission 042746-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5165 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location58233346-58275699 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 58263196 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091579] [ENSMUST00000223811] [ENSMUST00000224505] [ENSMUST00000225034]
Predicted Effect probably null
Transcript: ENSMUST00000091579
SMART Domains Protein: ENSMUSP00000089169
Gene: ENSMUSG00000021552

DomainStartEndE-ValueType
coiled coil region 47 80 N/A INTRINSIC
coiled coil region 128 157 N/A INTRINSIC
coiled coil region 243 299 N/A INTRINSIC
coiled coil region 321 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224273
Predicted Effect probably benign
Transcript: ENSMUST00000224505
Predicted Effect probably benign
Transcript: ENSMUST00000225034
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to the mouse cGMP-dependent protein kinase anchoring protein 42kDa. The mouse protein has been found to localize with the Golgi and recruit cGMP-dependent protein kinase I alpha to the Golgi in mouse testes. It is thought to play a role in germ cell development. Transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 T A 6: 83,526,832 I77F probably benign Het
Actl6a G A 3: 32,720,208 V285I probably benign Het
Adam9 A T 8: 24,967,174 I646N possibly damaging Het
Ahnak T C 19: 9,015,665 I4771T possibly damaging Het
Alas1 T C 9: 106,241,255 T223A probably damaging Het
Apc2 A G 10: 80,315,850 E2246G probably damaging Het
Atp1a1 A G 3: 101,581,789 I795T probably benign Het
Cdhr4 T C 9: 107,997,630 L633P probably damaging Het
Cep350 A G 1: 155,928,368 S990P probably damaging Het
Cplx2 A G 13: 54,378,976 I66V possibly damaging Het
Cx3cl1 T C 8: 94,779,876 S170P probably benign Het
Cyth1 T C 11: 118,169,082 N353S possibly damaging Het
Dapp1 T C 3: 137,939,215 probably null Het
Dmwd G A 7: 19,078,035 probably benign Het
Dsg1c A G 18: 20,277,023 H516R probably damaging Het
Efemp2 T C 19: 5,475,411 C39R probably damaging Het
Fnbp4 C G 2: 90,777,657 Q908E possibly damaging Het
Foxred2 A G 15: 77,956,012 V26A probably damaging Het
Gstcd A C 3: 133,084,679 V109G probably damaging Het
Hoxc9 T A 15: 102,984,000 M215K probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnj9 A T 1: 172,323,157 D296E probably benign Het
Kctd18 T C 1: 57,959,236 Y68C probably damaging Het
Kif21a A T 15: 90,956,376 M1179K probably benign Het
Lrfn5 T C 12: 61,839,624 I66T possibly damaging Het
Lrp12 A G 15: 39,872,461 S692P probably benign Het
Lrrc10 A T 10: 117,046,060 N213I probably benign Het
Mettl11b A G 1: 163,722,523 I53T probably benign Het
Nceh1 G A 3: 27,241,528 V313I probably benign Het
Nkx6-3 T A 8: 23,153,743 H53Q probably damaging Het
Nov A G 15: 54,749,189 D198G probably damaging Het
Olfr1276 T A 2: 111,257,223 V36E possibly damaging Het
Olfr128 A G 17: 37,924,361 D265G probably benign Het
Olfr1388 A G 11: 49,444,376 H175R probably damaging Het
Olfr1447 A T 19: 12,901,200 N193K probably benign Het
Oxct1 A T 15: 4,053,769 T157S possibly damaging Het
Pcdhga3 A G 18: 37,675,670 E392G possibly damaging Het
Polr1a T G 6: 71,967,925 Y1322D probably damaging Het
Prkdc T A 16: 15,678,272 S776T probably damaging Het
Ralgapb A G 2: 158,465,912 I1047V possibly damaging Het
Sertad4 A T 1: 192,846,822 S229T possibly damaging Het
Shank2 T A 7: 144,409,636 V327D possibly damaging Het
Skint6 A T 4: 112,865,668 V904E possibly damaging Het
Slfn8 A T 11: 83,017,127 Y197N probably damaging Het
Smo T A 6: 29,736,078 L23Q unknown Het
Snx29 T A 16: 11,420,775 M23K probably damaging Het
Synrg T C 11: 83,990,935 S366P probably benign Het
Tomm40 A G 7: 19,713,667 probably null Het
Tpcn1 T C 5: 120,557,945 E81G probably damaging Het
Trappc1 A G 11: 69,324,234 Q26R probably benign Het
Ttn T A 2: 76,776,556 probably null Het
Usp25 T A 16: 77,076,405 D450E possibly damaging Het
Zmynd19 T A 2: 24,958,189 Y132* probably null Het
Other mutations in Gkap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Gkap1 APN 13 58237039 missense probably damaging 1.00
IGL01556:Gkap1 APN 13 58263292 missense probably benign 0.10
IGL03134:Gkap1 APN 13 58263932 unclassified probably benign
R1263:Gkap1 UTSW 13 58255773 missense probably benign 0.03
R1750:Gkap1 UTSW 13 58237043 nonsense probably null
R4672:Gkap1 UTSW 13 58263956 missense possibly damaging 0.70
R7639:Gkap1 UTSW 13 58263970 missense probably damaging 0.99
R7721:Gkap1 UTSW 13 58236985 critical splice donor site probably null
R7775:Gkap1 UTSW 13 58251152 missense probably benign 0.09
R8519:Gkap1 UTSW 13 58238692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAACCTGCAACTGCTTTG -3'
(R):5'- AGCAGCTTGTGTGTTCATGC -3'

Sequencing Primer
(F):5'- CAACTGCTTTGCTCTGAGC -3'
(R):5'- GTTGCTTGAACAACCCTGGACAG -3'
Posted On2016-06-21