Incidental Mutation 'R5165:Lrp12'
ID395668
Institutional Source Beutler Lab
Gene Symbol Lrp12
Ensembl Gene ENSMUSG00000022305
Gene Namelow density lipoprotein-related protein 12
Synonyms
MMRRC Submission 042746-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R5165 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location39870589-39943994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39872461 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 692 (S692P)
Ref Sequence ENSEMBL: ENSMUSP00000105934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022916] [ENSMUST00000110305]
Predicted Effect probably benign
Transcript: ENSMUST00000022916
AA Change: S711P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022916
Gene: ENSMUSG00000022305
AA Change: S711P

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
CUB 47 159 3.23e-28 SMART
LDLa 167 202 1.27e-11 SMART
LDLa 214 256 1.04e-7 SMART
CUB 259 372 9.88e-24 SMART
LDLa 374 412 2.6e-3 SMART
LDLa 413 450 2.36e-6 SMART
LDLa 451 487 5.1e-11 SMART
low complexity region 630 646 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 708 722 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110305
AA Change: S692P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105934
Gene: ENSMUSG00000022305
AA Change: S692P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 28 140 3.23e-28 SMART
LDLa 148 183 1.27e-11 SMART
LDLa 195 237 1.04e-7 SMART
CUB 240 353 9.88e-24 SMART
LDLa 355 393 2.6e-3 SMART
LDLa 394 431 2.36e-6 SMART
LDLa 432 468 5.1e-11 SMART
low complexity region 611 627 N/A INTRINSIC
low complexity region 634 645 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor related protein family. The product of this gene is a transmembrane protein that is differentially expressed in many cancer cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 T A 6: 83,526,832 I77F probably benign Het
Actl6a G A 3: 32,720,208 V285I probably benign Het
Adam9 A T 8: 24,967,174 I646N possibly damaging Het
Ahnak T C 19: 9,015,665 I4771T possibly damaging Het
Alas1 T C 9: 106,241,255 T223A probably damaging Het
Apc2 A G 10: 80,315,850 E2246G probably damaging Het
Atp1a1 A G 3: 101,581,789 I795T probably benign Het
Cdhr4 T C 9: 107,997,630 L633P probably damaging Het
Cep350 A G 1: 155,928,368 S990P probably damaging Het
Cplx2 A G 13: 54,378,976 I66V possibly damaging Het
Cx3cl1 T C 8: 94,779,876 S170P probably benign Het
Cyth1 T C 11: 118,169,082 N353S possibly damaging Het
Dapp1 T C 3: 137,939,215 probably null Het
Dmwd G A 7: 19,078,035 probably benign Het
Dsg1c A G 18: 20,277,023 H516R probably damaging Het
Efemp2 T C 19: 5,475,411 C39R probably damaging Het
Fnbp4 C G 2: 90,777,657 Q908E possibly damaging Het
Foxred2 A G 15: 77,956,012 V26A probably damaging Het
Gkap1 A G 13: 58,263,196 probably null Het
Gstcd A C 3: 133,084,679 V109G probably damaging Het
Hoxc9 T A 15: 102,984,000 M215K probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnj9 A T 1: 172,323,157 D296E probably benign Het
Kctd18 T C 1: 57,959,236 Y68C probably damaging Het
Kif21a A T 15: 90,956,376 M1179K probably benign Het
Lrfn5 T C 12: 61,839,624 I66T possibly damaging Het
Lrrc10 A T 10: 117,046,060 N213I probably benign Het
Mettl11b A G 1: 163,722,523 I53T probably benign Het
Nceh1 G A 3: 27,241,528 V313I probably benign Het
Nkx6-3 T A 8: 23,153,743 H53Q probably damaging Het
Nov A G 15: 54,749,189 D198G probably damaging Het
Olfr1276 T A 2: 111,257,223 V36E possibly damaging Het
Olfr128 A G 17: 37,924,361 D265G probably benign Het
Olfr1388 A G 11: 49,444,376 H175R probably damaging Het
Olfr1447 A T 19: 12,901,200 N193K probably benign Het
Oxct1 A T 15: 4,053,769 T157S possibly damaging Het
Pcdhga3 A G 18: 37,675,670 E392G possibly damaging Het
Polr1a T G 6: 71,967,925 Y1322D probably damaging Het
Prkdc T A 16: 15,678,272 S776T probably damaging Het
Ralgapb A G 2: 158,465,912 I1047V possibly damaging Het
Sertad4 A T 1: 192,846,822 S229T possibly damaging Het
Shank2 T A 7: 144,409,636 V327D possibly damaging Het
Skint6 A T 4: 112,865,668 V904E possibly damaging Het
Slfn8 A T 11: 83,017,127 Y197N probably damaging Het
Smo T A 6: 29,736,078 L23Q unknown Het
Snx29 T A 16: 11,420,775 M23K probably damaging Het
Synrg T C 11: 83,990,935 S366P probably benign Het
Tomm40 A G 7: 19,713,667 probably null Het
Tpcn1 T C 5: 120,557,945 E81G probably damaging Het
Trappc1 A G 11: 69,324,234 Q26R probably benign Het
Ttn T A 2: 76,776,556 probably null Het
Usp25 T A 16: 77,076,405 D450E possibly damaging Het
Zmynd19 T A 2: 24,958,189 Y132* probably null Het
Other mutations in Lrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Lrp12 APN 15 39878101 missense probably damaging 1.00
IGL02501:Lrp12 APN 15 39877904 missense probably damaging 1.00
IGL02850:Lrp12 APN 15 39878575 missense probably damaging 1.00
IGL03365:Lrp12 APN 15 39872521 missense probably benign
R0010:Lrp12 UTSW 15 39878276 missense probably damaging 1.00
R0047:Lrp12 UTSW 15 39878239 missense probably damaging 1.00
R0416:Lrp12 UTSW 15 39878911 splice site probably benign
R0840:Lrp12 UTSW 15 39876158 missense probably damaging 1.00
R1053:Lrp12 UTSW 15 39877981 missense probably damaging 1.00
R1158:Lrp12 UTSW 15 39878431 missense probably damaging 1.00
R1288:Lrp12 UTSW 15 39878403 missense probably damaging 1.00
R1350:Lrp12 UTSW 15 39878250 nonsense probably null
R1416:Lrp12 UTSW 15 39878623 missense probably damaging 1.00
R1548:Lrp12 UTSW 15 39872506 missense probably damaging 0.99
R1691:Lrp12 UTSW 15 39872265 missense probably damaging 1.00
R1696:Lrp12 UTSW 15 39878361 missense probably damaging 0.99
R2050:Lrp12 UTSW 15 39872589 missense probably damaging 0.99
R2513:Lrp12 UTSW 15 39876111 missense probably damaging 1.00
R3415:Lrp12 UTSW 15 39878282 missense probably damaging 1.00
R3417:Lrp12 UTSW 15 39878282 missense probably damaging 1.00
R4118:Lrp12 UTSW 15 39877965 nonsense probably null
R4167:Lrp12 UTSW 15 39885013 missense probably damaging 1.00
R4214:Lrp12 UTSW 15 39872580 missense probably benign 0.33
R4643:Lrp12 UTSW 15 39872022 missense probably damaging 1.00
R5008:Lrp12 UTSW 15 39878456 missense probably damaging 1.00
R5061:Lrp12 UTSW 15 39878254 missense probably damaging 1.00
R5910:Lrp12 UTSW 15 39876043 intron probably null
R6038:Lrp12 UTSW 15 39872380 missense probably damaging 0.99
R6038:Lrp12 UTSW 15 39872380 missense probably damaging 0.99
R6047:Lrp12 UTSW 15 39872067 missense probably damaging 1.00
R6351:Lrp12 UTSW 15 39878188 missense probably damaging 1.00
R6392:Lrp12 UTSW 15 39872019 missense probably damaging 1.00
R7026:Lrp12 UTSW 15 39880170 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAATGTCCGAAGCTCCGTC -3'
(R):5'- GAGTCCGATGACACTGACACAG -3'

Sequencing Primer
(F):5'- GCTCCGTCTGAAACTGGAATTAGC -3'
(R):5'- GTCCGATGACACTGACACAGAAAATG -3'
Posted On2016-06-21