Mutagenetix > Incidental Mutations

Incidental Mutation 'R5165:Kif21a'

395671

Institutional Source

Beutler Lab

Gene Symbol

Kif21a

Ensembl Gene

ENSMUSG00000022629

Gene Name

kinesin family member 21A

Synonyms

N-5 kinesin

MMRRC Submission

042746-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5165 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

90933276-91049948 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 90956376 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1179 (M1179K)

Ref Sequence

ENSEMBL: ENSMUSP00000104911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067205] [ENSMUST00000088614] [ENSMUST00000100304] [ENSMUST00000109287] [ENSMUST00000109288] [ENSMUST00000229801]

Predicted Effect

probably benign
Transcript: ENSMUST00000067205
AA Change: M1186K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000066911
Gene: ENSMUSG00000022629
AA Change: M1186K

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	9e-9	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	557	N/A	INTRINSIC
low complexity region	571	585	N/A	INTRINSIC
low complexity region	589	628	N/A	INTRINSIC
low complexity region	700	713	N/A	INTRINSIC
coiled coil region	924	1008	N/A	INTRINSIC
coiled coil region	1043	1066	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1251	1271	N/A	INTRINSIC
WD40	1290	1327	1.21e-7	SMART
WD40	1330	1368	7.28e-2	SMART
WD40	1394	1432	3.33e-1	SMART
WD40	1435	1477	7e-4	SMART
WD40	1485	1523	2.4e-1	SMART
WD40	1527	1566	1.48e-2	SMART
WD40	1569	1606	2.07e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000088614
AA Change: M1199K

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000085985
Gene: ENSMUSG00000022629
AA Change: M1199K

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	1e-8	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	564	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
low complexity region	602	641	N/A	INTRINSIC
low complexity region	713	726	N/A	INTRINSIC
coiled coil region	937	1021	N/A	INTRINSIC
coiled coil region	1056	1079	N/A	INTRINSIC
low complexity region	1114	1125	N/A	INTRINSIC
low complexity region	1271	1283	N/A	INTRINSIC
low complexity region	1300	1316	N/A	INTRINSIC
WD40	1334	1371	1.21e-7	SMART
WD40	1374	1412	7.28e-2	SMART
WD40	1438	1476	3.33e-1	SMART
WD40	1479	1521	7e-4	SMART
WD40	1529	1567	2.4e-1	SMART
WD40	1571	1610	1.48e-2	SMART
WD40	1613	1650	2.07e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100304
AA Change: M1199K

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000097877
Gene: ENSMUSG00000022629
AA Change: M1199K

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	1e-8	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	564	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
low complexity region	602	641	N/A	INTRINSIC
low complexity region	713	726	N/A	INTRINSIC
coiled coil region	937	1021	N/A	INTRINSIC
coiled coil region	1056	1079	N/A	INTRINSIC
low complexity region	1271	1283	N/A	INTRINSIC
low complexity region	1300	1316	N/A	INTRINSIC
WD40	1334	1371	1.21e-7	SMART
WD40	1374	1412	7.28e-2	SMART
WD40	1438	1476	3.33e-1	SMART
WD40	1479	1521	7e-4	SMART
WD40	1529	1567	2.4e-1	SMART
WD40	1571	1610	1.48e-2	SMART
WD40	1613	1650	2.07e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109287
AA Change: M1186K

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000104910
Gene: ENSMUSG00000022629
AA Change: M1186K

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	9e-9	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	557	N/A	INTRINSIC
low complexity region	571	585	N/A	INTRINSIC
low complexity region	589	628	N/A	INTRINSIC
low complexity region	700	713	N/A	INTRINSIC
coiled coil region	924	1008	N/A	INTRINSIC
coiled coil region	1043	1066	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC
WD40	1229	1266	1.21e-7	SMART
WD40	1269	1307	7.28e-2	SMART
WD40	1333	1371	3.33e-1	SMART
WD40	1374	1416	7e-4	SMART
WD40	1424	1462	2.4e-1	SMART
WD40	1466	1505	1.48e-2	SMART
WD40	1508	1545	2.07e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109288
AA Change: M1179K

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000104911
Gene: ENSMUSG00000022629
AA Change: M1179K

Domain	Start	End	E-Value	Type
KISc	7	379	8.97e-163	SMART
Blast:KISc	469	513	9e-9	BLAST
low complexity region	514	525	N/A	INTRINSIC
low complexity region	542	557	N/A	INTRINSIC
low complexity region	571	585	N/A	INTRINSIC
low complexity region	589	628	N/A	INTRINSIC
low complexity region	700	713	N/A	INTRINSIC
coiled coil region	924	1008	N/A	INTRINSIC
coiled coil region	1043	1066	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
WD40	1235	1272	1.21e-7	SMART
WD40	1275	1313	7.28e-2	SMART
WD40	1339	1377	3.33e-1	SMART
WD40	1380	1422	7e-4	SMART
WD40	1430	1468	2.4e-1	SMART
WD40	1472	1511	1.48e-2	SMART
WD40	1514	1551	2.07e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000229801
AA Change: M161K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229864

Meta Mutation Damage Score

0.0843

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KIF4 subfamily of kinesin-like motor proteins. The encoded protein is characterized by an N-terminal motor domain a coiled-coil stalk domain and a C-terminal WD-40 repeat domain. This protein may be involved in microtubule dependent transport. Mutations in this gene are the cause of congenital fibrosis of extraocular muscles-1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actg2	T	A	6: 83,526,832	I77F	probably benign	Het
Actl6a	G	A	3: 32,720,208	V285I	probably benign	Het
Adam9	A	T	8: 24,967,174	I646N	possibly damaging	Het
Ahnak	T	C	19: 9,015,665	I4771T	possibly damaging	Het
Alas1	T	C	9: 106,241,255	T223A	probably damaging	Het
Apc2	A	G	10: 80,315,850	E2246G	probably damaging	Het
Atp1a1	A	G	3: 101,581,789	I795T	probably benign	Het
Cdhr4	T	C	9: 107,997,630	L633P	probably damaging	Het
Cep350	A	G	1: 155,928,368	S990P	probably damaging	Het
Cplx2	A	G	13: 54,378,976	I66V	possibly damaging	Het
Cx3cl1	T	C	8: 94,779,876	S170P	probably benign	Het
Cyth1	T	C	11: 118,169,082	N353S	possibly damaging	Het
Dapp1	T	C	3: 137,939,215		probably null	Het
Dmwd	G	A	7: 19,078,035		probably benign	Het
Dsg1c	A	G	18: 20,277,023	H516R	probably damaging	Het
Efemp2	T	C	19: 5,475,411	C39R	probably damaging	Het
Fnbp4	C	G	2: 90,777,657	Q908E	possibly damaging	Het
Foxred2	A	G	15: 77,956,012	V26A	probably damaging	Het
Gkap1	A	G	13: 58,263,196		probably null	Het
Gstcd	A	C	3: 133,084,679	V109G	probably damaging	Het
Hoxc9	T	A	15: 102,984,000	M215K	probably damaging	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Kcnj9	A	T	1: 172,323,157	D296E	probably benign	Het
Kctd18	T	C	1: 57,959,236	Y68C	probably damaging	Het
Lrfn5	T	C	12: 61,839,624	I66T	possibly damaging	Het
Lrp12	A	G	15: 39,872,461	S692P	probably benign	Het
Lrrc10	A	T	10: 117,046,060	N213I	probably benign	Het
Mettl11b	A	G	1: 163,722,523	I53T	probably benign	Het
Nceh1	G	A	3: 27,241,528	V313I	probably benign	Het
Nkx6-3	T	A	8: 23,153,743	H53Q	probably damaging	Het
Nov	A	G	15: 54,749,189	D198G	probably damaging	Het
Olfr1276	T	A	2: 111,257,223	V36E	possibly damaging	Het
Olfr128	A	G	17: 37,924,361	D265G	probably benign	Het
Olfr1388	A	G	11: 49,444,376	H175R	probably damaging	Het
Olfr1447	A	T	19: 12,901,200	N193K	probably benign	Het
Oxct1	A	T	15: 4,053,769	T157S	possibly damaging	Het
Pcdhga3	A	G	18: 37,675,670	E392G	possibly damaging	Het
Polr1a	T	G	6: 71,967,925	Y1322D	probably damaging	Het
Prkdc	T	A	16: 15,678,272	S776T	probably damaging	Het
Ralgapb	A	G	2: 158,465,912	I1047V	possibly damaging	Het
Sertad4	A	T	1: 192,846,822	S229T	possibly damaging	Het
Shank2	T	A	7: 144,409,636	V327D	possibly damaging	Het
Skint6	A	T	4: 112,865,668	V904E	possibly damaging	Het
Slfn8	A	T	11: 83,017,127	Y197N	probably damaging	Het
Smo	T	A	6: 29,736,078	L23Q	unknown	Het
Snx29	T	A	16: 11,420,775	M23K	probably damaging	Het
Synrg	T	C	11: 83,990,935	S366P	probably benign	Het
Tomm40	A	G	7: 19,713,667		probably null	Het
Tpcn1	T	C	5: 120,557,945	E81G	probably damaging	Het
Trappc1	A	G	11: 69,324,234	Q26R	probably benign	Het
Ttn	T	A	2: 76,776,556		probably null	Het
Usp25	T	A	16: 77,076,405	D450E	possibly damaging	Het
Zmynd19	T	A	2: 24,958,189	Y132*	probably null	Het

Other mutations in Kif21a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Kif21a	APN	15	90937301	missense	probably damaging	1.00
IGL01476:Kif21a	APN	15	90943864	missense	possibly damaging	0.66
IGL01617:Kif21a	APN	15	90995637	splice site	probably benign
IGL01736:Kif21a	APN	15	90959745	missense	possibly damaging	0.59
IGL01923:Kif21a	APN	15	90956430	missense	probably damaging	0.96
IGL01985:Kif21a	APN	15	90991767	missense	probably damaging	1.00
IGL02304:Kif21a	APN	15	90965535	missense	probably damaging	1.00
IGL02589:Kif21a	APN	15	90985286	missense	probably damaging	1.00
IGL03115:Kif21a	APN	15	90985395	missense	probably damaging	0.99
IGL03211:Kif21a	APN	15	90997963	missense	possibly damaging	0.73
IGL03372:Kif21a	APN	15	90956376	missense	probably benign	0.38
reflex	UTSW	15	90968358	missense	probably null	1.00
R0052:Kif21a	UTSW	15	90970857	missense	probably damaging	0.98
R0052:Kif21a	UTSW	15	90970857	missense	probably damaging	0.98
R0304:Kif21a	UTSW	15	90976521	splice site	probably null
R0378:Kif21a	UTSW	15	90969774	splice site	probably null
R0420:Kif21a	UTSW	15	90968054	unclassified	probably benign
R0536:Kif21a	UTSW	15	90959683	splice site	probably benign
R0826:Kif21a	UTSW	15	90997541	critical splice donor site	probably null
R0971:Kif21a	UTSW	15	90940581	missense	possibly damaging	0.46
R1052:Kif21a	UTSW	15	90935650	missense	probably benign	0.17
R1168:Kif21a	UTSW	15	90993753	missense	probably damaging	1.00
R1324:Kif21a	UTSW	15	90948322	critical splice donor site	probably null
R1471:Kif21a	UTSW	15	90956419	missense	probably benign	0.04
R1625:Kif21a	UTSW	15	90942175	missense	probably damaging	1.00
R1636:Kif21a	UTSW	15	90984805	splice site	probably benign
R1647:Kif21a	UTSW	15	90994367	missense	probably damaging	1.00
R1648:Kif21a	UTSW	15	90994367	missense	probably damaging	1.00
R1699:Kif21a	UTSW	15	90959743	missense	probably damaging	0.99
R1703:Kif21a	UTSW	15	90949047	splice site	probably null
R1795:Kif21a	UTSW	15	90972727	splice site	probably null
R1812:Kif21a	UTSW	15	90971766	missense	possibly damaging	0.63
R1959:Kif21a	UTSW	15	90970848	missense	probably damaging	0.99
R1960:Kif21a	UTSW	15	90970848	missense	probably damaging	0.99
R1961:Kif21a	UTSW	15	90970848	missense	probably damaging	0.99
R1996:Kif21a	UTSW	15	90994371	nonsense	probably null
R2230:Kif21a	UTSW	15	90985362	nonsense	probably null
R2231:Kif21a	UTSW	15	90985362	nonsense	probably null
R2232:Kif21a	UTSW	15	90985362	nonsense	probably null
R2424:Kif21a	UTSW	15	90971196	missense	probably damaging	1.00
R2429:Kif21a	UTSW	15	90998005	missense	probably damaging	1.00
R2513:Kif21a	UTSW	15	90994391	missense	possibly damaging	0.96
R2846:Kif21a	UTSW	15	90934464	missense	probably benign
R3027:Kif21a	UTSW	15	90972642	missense	probably damaging	0.99
R3624:Kif21a	UTSW	15	90965595	missense	probably damaging	0.99
R3820:Kif21a	UTSW	15	90968074	missense	probably benign	0.17
R3923:Kif21a	UTSW	15	90937294	missense	possibly damaging	0.46
R3962:Kif21a	UTSW	15	90985409	missense	probably damaging	1.00
R4355:Kif21a	UTSW	15	90970833	missense	probably benign	0.17
R4516:Kif21a	UTSW	15	90971142	missense	probably benign	0.38
R4530:Kif21a	UTSW	15	90968089	splice site	probably null
R4612:Kif21a	UTSW	15	90968223	splice site	probably null
R4674:Kif21a	UTSW	15	90940545	missense	possibly damaging	0.66
R4675:Kif21a	UTSW	15	90940545	missense	possibly damaging	0.66
R4698:Kif21a	UTSW	15	90956305	missense	possibly damaging	0.85
R4712:Kif21a	UTSW	15	90984755	missense	probably damaging	1.00
R4955:Kif21a	UTSW	15	90937190	missense	probably damaging	1.00
R4974:Kif21a	UTSW	15	90949010	missense	probably benign	0.16
R5034:Kif21a	UTSW	15	90968358	missense	probably null	1.00
R5464:Kif21a	UTSW	15	90993855	missense	probably damaging	1.00
R5541:Kif21a	UTSW	15	90968113	missense	probably damaging	0.99
R5757:Kif21a	UTSW	15	90951345	missense	probably damaging	1.00
R5936:Kif21a	UTSW	15	90935647	missense	possibly damaging	0.95
R5976:Kif21a	UTSW	15	90935812	missense	probably damaging	1.00
R6074:Kif21a	UTSW	15	90980892	missense	probably benign
R6638:Kif21a	UTSW	15	90966407	missense	probably damaging	1.00
R6723:Kif21a	UTSW	15	90940446	missense	probably damaging	0.97
R6785:Kif21a	UTSW	15	90935730	missense	probably damaging	1.00
R6977:Kif21a	UTSW	15	90980837	missense	probably damaging	1.00
R7058:Kif21a	UTSW	15	90948903	splice site	probably null
R7147:Kif21a	UTSW	15	90980883	missense	probably benign	0.13
R7290:Kif21a	UTSW	15	90967229	nonsense	probably null
R7438:Kif21a	UTSW	15	90993796	missense	probably benign	0.37
R7593:Kif21a	UTSW	15	90943861	missense	probably benign	0.03
R7661:Kif21a	UTSW	15	90980919	missense	possibly damaging	0.89
R7891:Kif21a	UTSW	15	90956314	missense	probably damaging	1.00
R8137:Kif21a	UTSW	15	90968442	missense	probably benign
R8182:Kif21a	UTSW	15	90935761	missense	possibly damaging	0.77
R8303:Kif21a	UTSW	15	90971196	missense	probably damaging	0.99
R8388:Kif21a	UTSW	15	90959124	missense	possibly damaging	0.60

Predicted Primers

PCR Primer
(F):5'- GGGCCAACAGTACCTAACAG -3'
(R):5'- GTTCCTCAATCAAGTTTCGTGC -3'

Sequencing Primer
(F):5'- TGACTTTGAAAACCAGAGATTGAG -3'
(R):5'- CCTACGCTGGCTTCTCATTG -3'

Posted On

2016-06-21