Incidental Mutation 'R5165:Usp25'
ID395675
Institutional Source Beutler Lab
Gene Symbol Usp25
Ensembl Gene ENSMUSG00000022867
Gene Nameubiquitin specific peptidase 25
Synonyms
MMRRC Submission 042746-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5165 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location77013706-77116780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77076405 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 450 (D450E)
Ref Sequence ENSEMBL: ENSMUSP00000023580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023580]
PDB Structure
Solution Structure of RSGI RUH-013, a UBA domain in Mouse cDNA [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023580
AA Change: D450E

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023580
Gene: ENSMUSG00000022867
AA Change: D450E

DomainStartEndE-ValueType
PDB:1VDL|A 1 67 2e-35 PDB
Blast:UBA 17 56 9e-16 BLAST
UIM 97 116 5.27e-3 SMART
Pfam:UIM 124 140 6.7e-3 PFAM
Pfam:UCH 168 655 9.3e-55 PFAM
Pfam:UCH_1 169 632 3.1e-14 PFAM
coiled coil region 685 714 N/A INTRINSIC
Meta Mutation Damage Score 0.4262 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (MIM 191339) is a highly conserved 76-amino acid protein involved in regulation of intracellular protein breakdown, cell cycle regulation, and stress response. Ubiquitin is released from degraded proteins by disassembly of the polyubiquitin chains, which is mediated by ubiquitin-specific proteases (USPs), such as USP25 (Valero et al., 1999 [PubMed 10644437]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased severity of IL17-induced pulmonary inflammation and MOG-induced experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 T A 6: 83,526,832 I77F probably benign Het
Actl6a G A 3: 32,720,208 V285I probably benign Het
Adam9 A T 8: 24,967,174 I646N possibly damaging Het
Ahnak T C 19: 9,015,665 I4771T possibly damaging Het
Alas1 T C 9: 106,241,255 T223A probably damaging Het
Apc2 A G 10: 80,315,850 E2246G probably damaging Het
Atp1a1 A G 3: 101,581,789 I795T probably benign Het
Cdhr4 T C 9: 107,997,630 L633P probably damaging Het
Cep350 A G 1: 155,928,368 S990P probably damaging Het
Cplx2 A G 13: 54,378,976 I66V possibly damaging Het
Cx3cl1 T C 8: 94,779,876 S170P probably benign Het
Cyth1 T C 11: 118,169,082 N353S possibly damaging Het
Dapp1 T C 3: 137,939,215 probably null Het
Dmwd G A 7: 19,078,035 probably benign Het
Dsg1c A G 18: 20,277,023 H516R probably damaging Het
Efemp2 T C 19: 5,475,411 C39R probably damaging Het
Fnbp4 C G 2: 90,777,657 Q908E possibly damaging Het
Foxred2 A G 15: 77,956,012 V26A probably damaging Het
Gkap1 A G 13: 58,263,196 probably null Het
Gstcd A C 3: 133,084,679 V109G probably damaging Het
Hoxc9 T A 15: 102,984,000 M215K probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnj9 A T 1: 172,323,157 D296E probably benign Het
Kctd18 T C 1: 57,959,236 Y68C probably damaging Het
Kif21a A T 15: 90,956,376 M1179K probably benign Het
Lrfn5 T C 12: 61,839,624 I66T possibly damaging Het
Lrp12 A G 15: 39,872,461 S692P probably benign Het
Lrrc10 A T 10: 117,046,060 N213I probably benign Het
Mettl11b A G 1: 163,722,523 I53T probably benign Het
Nceh1 G A 3: 27,241,528 V313I probably benign Het
Nkx6-3 T A 8: 23,153,743 H53Q probably damaging Het
Nov A G 15: 54,749,189 D198G probably damaging Het
Olfr1276 T A 2: 111,257,223 V36E possibly damaging Het
Olfr128 A G 17: 37,924,361 D265G probably benign Het
Olfr1388 A G 11: 49,444,376 H175R probably damaging Het
Olfr1447 A T 19: 12,901,200 N193K probably benign Het
Oxct1 A T 15: 4,053,769 T157S possibly damaging Het
Pcdhga3 A G 18: 37,675,670 E392G possibly damaging Het
Polr1a T G 6: 71,967,925 Y1322D probably damaging Het
Prkdc T A 16: 15,678,272 S776T probably damaging Het
Ralgapb A G 2: 158,465,912 I1047V possibly damaging Het
Sertad4 A T 1: 192,846,822 S229T possibly damaging Het
Shank2 T A 7: 144,409,636 V327D possibly damaging Het
Skint6 A T 4: 112,865,668 V904E possibly damaging Het
Slfn8 A T 11: 83,017,127 Y197N probably damaging Het
Smo T A 6: 29,736,078 L23Q unknown Het
Snx29 T A 16: 11,420,775 M23K probably damaging Het
Synrg T C 11: 83,990,935 S366P probably benign Het
Tomm40 A G 7: 19,713,667 probably null Het
Tpcn1 T C 5: 120,557,945 E81G probably damaging Het
Trappc1 A G 11: 69,324,234 Q26R probably benign Het
Ttn T A 2: 76,776,556 probably null Het
Zmynd19 T A 2: 24,958,189 Y132* probably null Het
Other mutations in Usp25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Usp25 APN 16 77062405 missense probably damaging 1.00
IGL01359:Usp25 APN 16 77059253 missense probably damaging 1.00
IGL01380:Usp25 APN 16 77093678 missense probably benign 0.06
IGL01614:Usp25 APN 16 77077117 missense probably damaging 1.00
IGL02065:Usp25 APN 16 77083782 missense probably benign 0.06
IGL02271:Usp25 APN 16 77115447 missense probably damaging 1.00
IGL03184:Usp25 APN 16 77081653 missense probably damaging 1.00
IGL03046:Usp25 UTSW 16 77074866 missense probably damaging 1.00
R0433:Usp25 UTSW 16 77109217 missense probably benign 0.02
R0741:Usp25 UTSW 16 77071708 missense possibly damaging 0.80
R0944:Usp25 UTSW 16 77081447 splice site probably benign
R1324:Usp25 UTSW 16 77080387 missense probably damaging 0.98
R1341:Usp25 UTSW 16 77115443 missense probably benign
R1373:Usp25 UTSW 16 77062385 splice site probably benign
R1641:Usp25 UTSW 16 77071671 missense possibly damaging 0.89
R1777:Usp25 UTSW 16 77081554 missense probably damaging 1.00
R1813:Usp25 UTSW 16 77114950 missense probably benign 0.00
R1960:Usp25 UTSW 16 77076371 missense probably damaging 1.00
R2256:Usp25 UTSW 16 77113794 missense probably benign
R2271:Usp25 UTSW 16 77076429 missense probably damaging 0.97
R4404:Usp25 UTSW 16 77115453 missense probably damaging 1.00
R4408:Usp25 UTSW 16 77115453 missense probably damaging 1.00
R4502:Usp25 UTSW 16 77115396 missense probably damaging 1.00
R4604:Usp25 UTSW 16 77115415 missense probably damaging 1.00
R4612:Usp25 UTSW 16 77033945 missense possibly damaging 0.92
R4744:Usp25 UTSW 16 77114989 missense probably damaging 1.00
R4867:Usp25 UTSW 16 77050467 missense probably damaging 1.00
R4932:Usp25 UTSW 16 77033982 critical splice donor site probably null
R5087:Usp25 UTSW 16 77077119 missense probably benign 0.00
R5184:Usp25 UTSW 16 77109227 missense probably benign 0.00
R5307:Usp25 UTSW 16 77093706 missense probably benign
R5331:Usp25 UTSW 16 77050558 missense probably damaging 1.00
R5355:Usp25 UTSW 16 77050454 missense probably damaging 1.00
R5479:Usp25 UTSW 16 77107913 missense possibly damaging 0.51
R5619:Usp25 UTSW 16 77033945 missense probably benign 0.22
R5646:Usp25 UTSW 16 77050472 missense probably benign 0.34
R5946:Usp25 UTSW 16 77115054 nonsense probably null
R6013:Usp25 UTSW 16 77077021 missense probably benign 0.00
R6418:Usp25 UTSW 16 77062442 missense probably damaging 1.00
R6653:Usp25 UTSW 16 77059288 missense probably benign 0.29
R6709:Usp25 UTSW 16 77083932 missense probably benign
R6987:Usp25 UTSW 16 77077180 missense probably damaging 1.00
R7418:Usp25 UTSW 16 77113842 nonsense probably null
R7500:Usp25 UTSW 16 77077201 missense probably damaging 1.00
R7886:Usp25 UTSW 16 77113771 missense probably damaging 0.99
R7961:Usp25 UTSW 16 77059262 missense probably damaging 1.00
R8005:Usp25 UTSW 16 77077068 missense probably benign
R8046:Usp25 UTSW 16 77109175 missense probably damaging 1.00
R8069:Usp25 UTSW 16 77069055 missense possibly damaging 0.58
R8140:Usp25 UTSW 16 77071681 nonsense probably null
R8167:Usp25 UTSW 16 77107931 missense probably damaging 1.00
R8437:Usp25 UTSW 16 77033912 missense probably damaging 1.00
X0065:Usp25 UTSW 16 77081556 missense probably damaging 1.00
Z1176:Usp25 UTSW 16 77071791 missense probably damaging 0.98
Z1176:Usp25 UTSW 16 77071792 missense possibly damaging 0.93
Z1176:Usp25 UTSW 16 77081521 missense probably damaging 1.00
Z1176:Usp25 UTSW 16 77083913 missense probably benign
Z1176:Usp25 UTSW 16 77113830 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGTTTAGAACACCGTCTTAGG -3'
(R):5'- AGACAAGACCTCCTGAATTGATG -3'

Sequencing Primer
(F):5'- TGCGGCCATACATAGGACTTG -3'
(R):5'- ACCTCCTGAATTGATGAGGAATAAG -3'
Posted On2016-06-21