Incidental Mutation 'R5165:Olfr128'
ID395676
Institutional Source Beutler Lab
Gene Symbol Olfr128
Ensembl Gene ENSMUSG00000059030
Gene Nameolfactory receptor 128
SynonymsMOR218-13, GA_x6K02T2PSCP-2374126-2375048
MMRRC Submission 042746-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5165 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37920548-37926801 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37924361 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 265 (D265G)
Ref Sequence ENSEMBL: ENSMUSP00000151065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080231] [ENSMUST00000216440]
Predicted Effect probably benign
Transcript: ENSMUST00000080231
AA Change: D265G

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000079121
Gene: ENSMUSG00000059030
AA Change: D265G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.1e-5 PFAM
Pfam:7tm_1 41 290 1.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216440
AA Change: D265G

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 T A 6: 83,526,832 I77F probably benign Het
Actl6a G A 3: 32,720,208 V285I probably benign Het
Adam9 A T 8: 24,967,174 I646N possibly damaging Het
Ahnak T C 19: 9,015,665 I4771T possibly damaging Het
Alas1 T C 9: 106,241,255 T223A probably damaging Het
Apc2 A G 10: 80,315,850 E2246G probably damaging Het
Atp1a1 A G 3: 101,581,789 I795T probably benign Het
Cdhr4 T C 9: 107,997,630 L633P probably damaging Het
Cep350 A G 1: 155,928,368 S990P probably damaging Het
Cplx2 A G 13: 54,378,976 I66V possibly damaging Het
Cx3cl1 T C 8: 94,779,876 S170P probably benign Het
Cyth1 T C 11: 118,169,082 N353S possibly damaging Het
Dapp1 T C 3: 137,939,215 probably null Het
Dmwd G A 7: 19,078,035 probably benign Het
Dsg1c A G 18: 20,277,023 H516R probably damaging Het
Efemp2 T C 19: 5,475,411 C39R probably damaging Het
Fnbp4 C G 2: 90,777,657 Q908E possibly damaging Het
Foxred2 A G 15: 77,956,012 V26A probably damaging Het
Gkap1 A G 13: 58,263,196 probably null Het
Gstcd A C 3: 133,084,679 V109G probably damaging Het
Hoxc9 T A 15: 102,984,000 M215K probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnj9 A T 1: 172,323,157 D296E probably benign Het
Kctd18 T C 1: 57,959,236 Y68C probably damaging Het
Kif21a A T 15: 90,956,376 M1179K probably benign Het
Lrfn5 T C 12: 61,839,624 I66T possibly damaging Het
Lrp12 A G 15: 39,872,461 S692P probably benign Het
Lrrc10 A T 10: 117,046,060 N213I probably benign Het
Mettl11b A G 1: 163,722,523 I53T probably benign Het
Nceh1 G A 3: 27,241,528 V313I probably benign Het
Nkx6-3 T A 8: 23,153,743 H53Q probably damaging Het
Nov A G 15: 54,749,189 D198G probably damaging Het
Olfr1276 T A 2: 111,257,223 V36E possibly damaging Het
Olfr1388 A G 11: 49,444,376 H175R probably damaging Het
Olfr1447 A T 19: 12,901,200 N193K probably benign Het
Oxct1 A T 15: 4,053,769 T157S possibly damaging Het
Pcdhga3 A G 18: 37,675,670 E392G possibly damaging Het
Polr1a T G 6: 71,967,925 Y1322D probably damaging Het
Prkdc T A 16: 15,678,272 S776T probably damaging Het
Ralgapb A G 2: 158,465,912 I1047V possibly damaging Het
Sertad4 A T 1: 192,846,822 S229T possibly damaging Het
Shank2 T A 7: 144,409,636 V327D possibly damaging Het
Skint6 A T 4: 112,865,668 V904E possibly damaging Het
Slfn8 A T 11: 83,017,127 Y197N probably damaging Het
Smo T A 6: 29,736,078 L23Q unknown Het
Snx29 T A 16: 11,420,775 M23K probably damaging Het
Synrg T C 11: 83,990,935 S366P probably benign Het
Tomm40 A G 7: 19,713,667 probably null Het
Tpcn1 T C 5: 120,557,945 E81G probably damaging Het
Trappc1 A G 11: 69,324,234 Q26R probably benign Het
Ttn T A 2: 76,776,556 probably null Het
Usp25 T A 16: 77,076,405 D450E possibly damaging Het
Zmynd19 T A 2: 24,958,189 Y132* probably null Het
Other mutations in Olfr128
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Olfr128 APN 17 37923959 missense possibly damaging 0.73
IGL01940:Olfr128 APN 17 37924286 missense probably damaging 1.00
R0427:Olfr128 UTSW 17 37923629 missense probably benign 0.00
R0462:Olfr128 UTSW 17 37923776 missense probably damaging 1.00
R0546:Olfr128 UTSW 17 37924338 nonsense probably null
R0760:Olfr128 UTSW 17 37924114 nonsense probably null
R0940:Olfr128 UTSW 17 37923700 missense probably damaging 0.98
R1898:Olfr128 UTSW 17 37923625 missense possibly damaging 0.91
R1935:Olfr128 UTSW 17 37924102 missense probably damaging 1.00
R2060:Olfr128 UTSW 17 37923880 missense probably benign 0.00
R4680:Olfr128 UTSW 17 37923922 missense probably damaging 1.00
R5526:Olfr128 UTSW 17 37924492 makesense probably null
R5594:Olfr128 UTSW 17 37923611 missense probably benign 0.00
R5751:Olfr128 UTSW 17 37923970 missense probably benign 0.44
R6330:Olfr128 UTSW 17 37923794 missense possibly damaging 0.77
R7123:Olfr128 UTSW 17 37923676 missense probably benign 0.33
R7354:Olfr128 UTSW 17 37924393 missense probably benign 0.00
R7827:Olfr128 UTSW 17 37923677 nonsense probably null
R8258:Olfr128 UTSW 17 37923956 missense probably damaging 1.00
R8259:Olfr128 UTSW 17 37923956 missense probably damaging 1.00
Z1177:Olfr128 UTSW 17 37923727 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCTGCTCTAATGATGACTTTGGAC -3'
(R):5'- TGTGTGCAGTGTTAGCAGAC -3'

Sequencing Primer
(F):5'- GACTTTGGACTACTGAAAGTGTC -3'
(R):5'- GTGTTAGCAGACACTAAAACCAG -3'
Posted On2016-06-21