Mutagenetix > Incidental Mutations

Incidental Mutation 'R5165:Olfr128'

395676

Institutional Source

Beutler Lab

Gene Symbol

Olfr128

Ensembl Gene

ENSMUSG00000059030

Gene Name

olfactory receptor 128

Synonyms

MOR218-13, GA_x6K02T2PSCP-2374126-2375048

MMRRC Submission

042746-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R5165 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37920548-37926801 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 37924361 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 265 (D265G)

Ref Sequence

ENSEMBL: ENSMUSP00000151065 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080231] [ENSMUST00000216440]

Predicted Effect

probably benign
Transcript: ENSMUST00000080231
AA Change: D265G

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000079121
Gene: ENSMUSG00000059030
AA Change: D265G

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	1.3e-46	PFAM
Pfam:7TM_GPCR_Srsx	35	305	1.1e-5	PFAM
Pfam:7tm_1	41	290	1.6e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000216440
AA Change: D265G

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actg2	T	A	6: 83,526,832	I77F	probably benign	Het
Actl6a	G	A	3: 32,720,208	V285I	probably benign	Het
Adam9	A	T	8: 24,967,174	I646N	possibly damaging	Het
Ahnak	T	C	19: 9,015,665	I4771T	possibly damaging	Het
Alas1	T	C	9: 106,241,255	T223A	probably damaging	Het
Apc2	A	G	10: 80,315,850	E2246G	probably damaging	Het
Atp1a1	A	G	3: 101,581,789	I795T	probably benign	Het
Cdhr4	T	C	9: 107,997,630	L633P	probably damaging	Het
Cep350	A	G	1: 155,928,368	S990P	probably damaging	Het
Cplx2	A	G	13: 54,378,976	I66V	possibly damaging	Het
Cx3cl1	T	C	8: 94,779,876	S170P	probably benign	Het
Cyth1	T	C	11: 118,169,082	N353S	possibly damaging	Het
Dapp1	T	C	3: 137,939,215		probably null	Het
Dmwd	G	A	7: 19,078,035		probably benign	Het
Dsg1c	A	G	18: 20,277,023	H516R	probably damaging	Het
Efemp2	T	C	19: 5,475,411	C39R	probably damaging	Het
Fnbp4	C	G	2: 90,777,657	Q908E	possibly damaging	Het
Foxred2	A	G	15: 77,956,012	V26A	probably damaging	Het
Gkap1	A	G	13: 58,263,196		probably null	Het
Gstcd	A	C	3: 133,084,679	V109G	probably damaging	Het
Hoxc9	T	A	15: 102,984,000	M215K	probably damaging	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Kcnj9	A	T	1: 172,323,157	D296E	probably benign	Het
Kctd18	T	C	1: 57,959,236	Y68C	probably damaging	Het
Kif21a	A	T	15: 90,956,376	M1179K	probably benign	Het
Lrfn5	T	C	12: 61,839,624	I66T	possibly damaging	Het
Lrp12	A	G	15: 39,872,461	S692P	probably benign	Het
Lrrc10	A	T	10: 117,046,060	N213I	probably benign	Het
Mettl11b	A	G	1: 163,722,523	I53T	probably benign	Het
Nceh1	G	A	3: 27,241,528	V313I	probably benign	Het
Nkx6-3	T	A	8: 23,153,743	H53Q	probably damaging	Het
Nov	A	G	15: 54,749,189	D198G	probably damaging	Het
Olfr1276	T	A	2: 111,257,223	V36E	possibly damaging	Het
Olfr1388	A	G	11: 49,444,376	H175R	probably damaging	Het
Olfr1447	A	T	19: 12,901,200	N193K	probably benign	Het
Oxct1	A	T	15: 4,053,769	T157S	possibly damaging	Het
Pcdhga3	A	G	18: 37,675,670	E392G	possibly damaging	Het
Polr1a	T	G	6: 71,967,925	Y1322D	probably damaging	Het
Prkdc	T	A	16: 15,678,272	S776T	probably damaging	Het
Ralgapb	A	G	2: 158,465,912	I1047V	possibly damaging	Het
Sertad4	A	T	1: 192,846,822	S229T	possibly damaging	Het
Shank2	T	A	7: 144,409,636	V327D	possibly damaging	Het
Skint6	A	T	4: 112,865,668	V904E	possibly damaging	Het
Slfn8	A	T	11: 83,017,127	Y197N	probably damaging	Het
Smo	T	A	6: 29,736,078	L23Q	unknown	Het
Snx29	T	A	16: 11,420,775	M23K	probably damaging	Het
Synrg	T	C	11: 83,990,935	S366P	probably benign	Het
Tomm40	A	G	7: 19,713,667		probably null	Het
Tpcn1	T	C	5: 120,557,945	E81G	probably damaging	Het
Trappc1	A	G	11: 69,324,234	Q26R	probably benign	Het
Ttn	T	A	2: 76,776,556		probably null	Het
Usp25	T	A	16: 77,076,405	D450E	possibly damaging	Het
Zmynd19	T	A	2: 24,958,189	Y132*	probably null	Het

Other mutations in Olfr128

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01922:Olfr128	APN	17	37923959	missense	possibly damaging	0.73
IGL01940:Olfr128	APN	17	37924286	missense	probably damaging	1.00
R0427:Olfr128	UTSW	17	37923629	missense	probably benign	0.00
R0462:Olfr128	UTSW	17	37923776	missense	probably damaging	1.00
R0546:Olfr128	UTSW	17	37924338	nonsense	probably null
R0760:Olfr128	UTSW	17	37924114	nonsense	probably null
R0940:Olfr128	UTSW	17	37923700	missense	probably damaging	0.98
R1898:Olfr128	UTSW	17	37923625	missense	possibly damaging	0.91
R1935:Olfr128	UTSW	17	37924102	missense	probably damaging	1.00
R2060:Olfr128	UTSW	17	37923880	missense	probably benign	0.00
R4680:Olfr128	UTSW	17	37923922	missense	probably damaging	1.00
R5526:Olfr128	UTSW	17	37924492	makesense	probably null
R5594:Olfr128	UTSW	17	37923611	missense	probably benign	0.00
R5751:Olfr128	UTSW	17	37923970	missense	probably benign	0.44
R6330:Olfr128	UTSW	17	37923794	missense	possibly damaging	0.77
R7123:Olfr128	UTSW	17	37923676	missense	probably benign	0.33
R7354:Olfr128	UTSW	17	37924393	missense	probably benign	0.00
R7827:Olfr128	UTSW	17	37923677	nonsense	probably null
R8258:Olfr128	UTSW	17	37923956	missense	probably damaging	1.00
R8259:Olfr128	UTSW	17	37923956	missense	probably damaging	1.00
Z1177:Olfr128	UTSW	17	37923727	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CCTGCTCTAATGATGACTTTGGAC -3'
(R):5'- TGTGTGCAGTGTTAGCAGAC -3'

Sequencing Primer
(F):5'- GACTTTGGACTACTGAAAGTGTC -3'
(R):5'- GTGTTAGCAGACACTAAAACCAG -3'

Posted On

2016-06-21