Incidental Mutation 'R5165:Efemp2'
ID395679
Institutional Source Beutler Lab
Gene Symbol Efemp2
Ensembl Gene ENSMUSG00000024909
Gene Nameepidermal growth factor-containing fibulin-like extracellular matrix protein 2
SynonymsMBP1, fibulin-4, Fbln4, 0610011K11Rik, fibulin 4
MMRRC Submission 042746-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5165 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5473973-5481853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5475411 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 39 (C39R)
Ref Sequence ENSEMBL: ENSMUSP00000127312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070118] [ENSMUST00000165485] [ENSMUST00000166253] [ENSMUST00000166303] [ENSMUST00000167304] [ENSMUST00000167371] [ENSMUST00000167827] [ENSMUST00000167855] [ENSMUST00000168330] [ENSMUST00000169943]
Predicted Effect probably damaging
Transcript: ENSMUST00000070118
AA Change: C58R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064719
Gene: ENSMUSG00000024909
AA Change: C58R

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
EGF_like 73 113 2.74e-1 SMART
low complexity region 115 130 N/A INTRINSIC
EGF_CA 142 182 1.08e-10 SMART
EGF_CA 183 221 1.94e-12 SMART
EGF_CA 222 261 1.36e-7 SMART
EGF_CA 262 301 2.19e-11 SMART
EGF 305 347 1.95e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000164204
AA Change: C21R
SMART Domains Protein: ENSMUSP00000128414
Gene: ENSMUSG00000024909
AA Change: C21R

DomainStartEndE-ValueType
Pfam:EGF_CA 37 69 5.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164388
SMART Domains Protein: ENSMUSP00000131979
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
EGF 4 35 1.59e1 SMART
EGF 39 81 1.95e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165485
AA Change: C39R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133016
Gene: ENSMUSG00000024909
AA Change: C39R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_like 54 94 2.74e-1 SMART
low complexity region 96 111 N/A INTRINSIC
EGF_CA 123 163 1.08e-10 SMART
EGF_CA 164 202 1.94e-12 SMART
EGF_CA 203 242 1.36e-7 SMART
EGF_CA 243 282 2.19e-11 SMART
EGF 286 328 1.95e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166253
AA Change: C39R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127312
Gene: ENSMUSG00000024909
AA Change: C39R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 54 92 1.94e-12 SMART
EGF_CA 93 132 1.36e-7 SMART
EGF_CA 133 172 2.19e-11 SMART
EGF 176 218 1.95e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166303
AA Change: C51R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128827
Gene: ENSMUSG00000024909
AA Change: C51R

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166558
Predicted Effect possibly damaging
Transcript: ENSMUST00000167304
AA Change: C39R

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129982
Gene: ENSMUSG00000024909
AA Change: C39R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EGF_CA 54 86 2.4e-9 PFAM
low complexity region 96 111 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167371
AA Change: C39R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129746
Gene: ENSMUSG00000024909
AA Change: C39R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_like 54 94 2.74e-1 SMART
low complexity region 96 111 N/A INTRINSIC
EGF_CA 123 161 1.94e-12 SMART
EGF_CA 162 201 1.36e-7 SMART
EGF_CA 202 241 2.19e-11 SMART
EGF 245 287 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167827
SMART Domains Protein: ENSMUSP00000127478
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
Blast:EGF_like 1 26 9e-10 BLAST
low complexity region 28 43 N/A INTRINSIC
EGF_CA 55 95 1.08e-10 SMART
EGF_CA 96 134 1.94e-12 SMART
EGF_CA 135 174 1.36e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167855
SMART Domains Protein: ENSMUSP00000132194
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
Blast:EGF_like 1 26 4e-10 BLAST
low complexity region 28 43 N/A INTRINSIC
EGF_CA 55 95 1.08e-10 SMART
EGF_CA 96 134 1.94e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167920
Predicted Effect probably benign
Transcript: ENSMUST00000168330
Predicted Effect possibly damaging
Transcript: ENSMUST00000169943
AA Change: C39R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126477
Gene: ENSMUSG00000024909
AA Change: C39R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Meta Mutation Damage Score 0.9354 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large number of extracellular matrix proteins have been found to contain variations of the epidermal growth factor (EGF) domain and have been implicated in functions as diverse as blood coagulation, activation of complement and determination of cell fate during development. The protein encoded by this gene contains four EGF2 domains and six calcium-binding EGF2 domains. This gene is necessary for elastic fiber formation and connective tissue development. Defects in this gene are cause of an autosomal recessive cutis laxa syndrome. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality with abnormal artery and lung morphology and defects in vascular, pulmonary, and hypodermal elastic fibers. Some alleles of Mus81 also affect expression of this gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actg2 T A 6: 83,526,832 I77F probably benign Het
Actl6a G A 3: 32,720,208 V285I probably benign Het
Adam9 A T 8: 24,967,174 I646N possibly damaging Het
Ahnak T C 19: 9,015,665 I4771T possibly damaging Het
Alas1 T C 9: 106,241,255 T223A probably damaging Het
Apc2 A G 10: 80,315,850 E2246G probably damaging Het
Atp1a1 A G 3: 101,581,789 I795T probably benign Het
Cdhr4 T C 9: 107,997,630 L633P probably damaging Het
Cep350 A G 1: 155,928,368 S990P probably damaging Het
Cplx2 A G 13: 54,378,976 I66V possibly damaging Het
Cx3cl1 T C 8: 94,779,876 S170P probably benign Het
Cyth1 T C 11: 118,169,082 N353S possibly damaging Het
Dapp1 T C 3: 137,939,215 probably null Het
Dmwd G A 7: 19,078,035 probably benign Het
Dsg1c A G 18: 20,277,023 H516R probably damaging Het
Fnbp4 C G 2: 90,777,657 Q908E possibly damaging Het
Foxred2 A G 15: 77,956,012 V26A probably damaging Het
Gkap1 A G 13: 58,263,196 probably null Het
Gstcd A C 3: 133,084,679 V109G probably damaging Het
Hoxc9 T A 15: 102,984,000 M215K probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnj9 A T 1: 172,323,157 D296E probably benign Het
Kctd18 T C 1: 57,959,236 Y68C probably damaging Het
Kif21a A T 15: 90,956,376 M1179K probably benign Het
Lrfn5 T C 12: 61,839,624 I66T possibly damaging Het
Lrp12 A G 15: 39,872,461 S692P probably benign Het
Lrrc10 A T 10: 117,046,060 N213I probably benign Het
Mettl11b A G 1: 163,722,523 I53T probably benign Het
Nceh1 G A 3: 27,241,528 V313I probably benign Het
Nkx6-3 T A 8: 23,153,743 H53Q probably damaging Het
Nov A G 15: 54,749,189 D198G probably damaging Het
Olfr1276 T A 2: 111,257,223 V36E possibly damaging Het
Olfr128 A G 17: 37,924,361 D265G probably benign Het
Olfr1388 A G 11: 49,444,376 H175R probably damaging Het
Olfr1447 A T 19: 12,901,200 N193K probably benign Het
Oxct1 A T 15: 4,053,769 T157S possibly damaging Het
Pcdhga3 A G 18: 37,675,670 E392G possibly damaging Het
Polr1a T G 6: 71,967,925 Y1322D probably damaging Het
Prkdc T A 16: 15,678,272 S776T probably damaging Het
Ralgapb A G 2: 158,465,912 I1047V possibly damaging Het
Sertad4 A T 1: 192,846,822 S229T possibly damaging Het
Shank2 T A 7: 144,409,636 V327D possibly damaging Het
Skint6 A T 4: 112,865,668 V904E possibly damaging Het
Slfn8 A T 11: 83,017,127 Y197N probably damaging Het
Smo T A 6: 29,736,078 L23Q unknown Het
Snx29 T A 16: 11,420,775 M23K probably damaging Het
Synrg T C 11: 83,990,935 S366P probably benign Het
Tomm40 A G 7: 19,713,667 probably null Het
Tpcn1 T C 5: 120,557,945 E81G probably damaging Het
Trappc1 A G 11: 69,324,234 Q26R probably benign Het
Ttn T A 2: 76,776,556 probably null Het
Usp25 T A 16: 77,076,405 D450E possibly damaging Het
Zmynd19 T A 2: 24,958,189 Y132* probably null Het
Other mutations in Efemp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03011:Efemp2 APN 19 5480065 missense probably damaging 0.99
IGL03079:Efemp2 APN 19 5475127 missense probably damaging 1.00
H8562:Efemp2 UTSW 19 5480649 missense probably benign 0.43
R0149:Efemp2 UTSW 19 5477960 missense probably damaging 1.00
R0266:Efemp2 UTSW 19 5477999 missense probably damaging 1.00
R0594:Efemp2 UTSW 19 5475063 unclassified probably benign
R0723:Efemp2 UTSW 19 5480050 missense probably damaging 1.00
R2110:Efemp2 UTSW 19 5475162 missense probably damaging 1.00
R4307:Efemp2 UTSW 19 5481621 missense possibly damaging 0.82
R4494:Efemp2 UTSW 19 5480311 missense probably damaging 1.00
R4878:Efemp2 UTSW 19 5480761 unclassified probably benign
R4889:Efemp2 UTSW 19 5475120 missense probably null 1.00
R5156:Efemp2 UTSW 19 5477678 missense possibly damaging 0.93
R6932:Efemp2 UTSW 19 5480245 missense probably damaging 1.00
R7171:Efemp2 UTSW 19 5480257 missense probably benign 0.00
R8017:Efemp2 UTSW 19 5477680 nonsense probably null
R8019:Efemp2 UTSW 19 5477680 nonsense probably null
R8037:Efemp2 UTSW 19 5480113 nonsense probably null
R8051:Efemp2 UTSW 19 5476067 missense probably damaging 1.00
R8101:Efemp2 UTSW 19 5476218 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACAGTGAGATCAGGATCCTG -3'
(R):5'- CTCCTAACTGAGTGGCACAAG -3'

Sequencing Primer
(F):5'- ATCAGGATCCTGGGGAGGC -3'
(R):5'- AGCATGGCTGGCTACCAAG -3'
Posted On2016-06-21