Mutagenetix > Incidental Mutations

Incidental Mutation 'R5039:Pcdh10'

List |< first << previous [record 38 of 53] next >> last >|

395689

Institutional Source

Beutler Lab

Gene Symbol

Pcdh10

Ensembl Gene

ENSMUSG00000049100

Gene Name

protocadherin 10

Synonyms

6430521D13Rik, OL-pc, 6430703F07Rik

MMRRC Submission

042629-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.248) question?

Stock #

R5039 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45378398-45435623 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 45381861 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 870 (N870S)

Ref Sequence

ENSEMBL: ENSMUSP00000141529 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166126] [ENSMUST00000170695] [ENSMUST00000171554] [ENSMUST00000193252]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166126
AA Change: N870S

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000131073
Gene: ENSMUSG00000049100
AA Change: N870S

Domain	Start	End	E-Value	Type
CA	34	120	1.64e-2	SMART
CA	144	248	1.46e-12	SMART
CA	272	356	2.88e-25	SMART
CA	380	461	1.9e-25	SMART
CA	485	572	1.8e-26	SMART
CA	603	686	8.29e-17	SMART
low complexity region	687	697	N/A	INTRINSIC
Pfam:Cadherin_C_2	713	838	5e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170695
AA Change: N870S

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000132769
Gene: ENSMUSG00000049100
AA Change: N870S

Domain	Start	End	E-Value	Type
CA	34	120	1.64e-2	SMART
CA	144	248	1.46e-12	SMART
CA	272	356	2.88e-25	SMART
CA	380	461	1.9e-25	SMART
CA	485	572	1.8e-26	SMART
CA	603	686	8.29e-17	SMART
low complexity region	687	697	N/A	INTRINSIC
transmembrane domain	716	738	N/A	INTRINSIC
low complexity region	751	772	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171554
AA Change: N870S

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000131600
Gene: ENSMUSG00000049100
AA Change: N870S

Domain	Start	End	E-Value	Type
CA	34	120	1.64e-2	SMART
CA	144	248	1.46e-12	SMART
CA	272	356	2.88e-25	SMART
CA	380	461	1.9e-25	SMART
CA	485	572	1.8e-26	SMART
CA	603	686	8.29e-17	SMART
low complexity region	687	697	N/A	INTRINSIC
transmembrane domain	716	738	N/A	INTRINSIC
low complexity region	751	772	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181047

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191843

Predicted Effect

probably damaging
Transcript: ENSMUST00000193252
AA Change: N870S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141529
Gene: ENSMUSG00000049100
AA Change: N870S

Domain	Start	End	E-Value	Type
CA	34	120	1.64e-2	SMART
CA	144	248	1.46e-12	SMART
CA	272	356	2.88e-25	SMART
CA	380	461	1.9e-25	SMART
CA	485	572	1.8e-26	SMART
CA	603	686	8.29e-17	SMART
low complexity region	687	697	N/A	INTRINSIC
transmembrane domain	716	738	N/A	INTRINSIC
low complexity region	751	772	N/A	INTRINSIC
low complexity region	887	896	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195655

Meta Mutation Damage Score

0.0984

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This family member contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein is a cadherin-related neuronal receptor thought to function in the establishment of specific cell-cell connections in the brain. This gene plays a role in inhibiting cancer cell motility and cell migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele die within several weeks of birth and exhibit decreased body size and defective striatal axon growth and thalamocortical projections in the ventral telencephalon. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	C	17: 33,067,760	C23G	probably damaging	Het
Abcg4	G	A	9: 44,281,566	A161V	probably damaging	Het
Anapc2	T	C	2: 25,274,796	I64T	possibly damaging	Het
Arfgef1	T	C	1: 10,199,736	D396G	probably benign	Het
Axl	C	T	7: 25,785,915	V163M	probably damaging	Het
Blm	G	A	7: 80,505,873	P353S	possibly damaging	Het
Btaf1	T	C	19: 36,990,762	Y1116H	probably benign	Het
Ccdc18	T	A	5: 108,158,648		probably null	Het
Ccdc87	T	C	19: 4,840,401		probably null	Het
Cdhr1	T	C	14: 37,079,643	N781S	probably benign	Het
Ctr9	C	A	7: 111,042,857	H297Q	probably benign	Het
Cyp2c55	A	G	19: 39,038,143	D398G	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dnmt3l	T	C	10: 78,052,900		probably null	Het
Dock4	C	A	12: 40,817,746	N1440K	probably damaging	Het
Etnk1	T	A	6: 143,195,317		probably null	Het
Fam120a	A	T	13: 48,910,250		probably null	Het
Fanca	T	C	8: 123,284,046	D908G	probably benign	Het
Gm17535	T	A	9: 3,035,786	L218H	probably benign	Het
Gm3633	A	C	14: 42,639,204	N42K	possibly damaging	Het
Gm4781	C	A	10: 100,396,989		noncoding transcript	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Gpr139	A	G	7: 119,144,942	V140A	probably benign	Het
Ighv1-62-3	G	T	12: 115,461,394	T13K	probably benign	Het
Itgb2l	T	C	16: 96,425,005	T629A	possibly damaging	Het
Kcnb2	T	C	1: 15,709,500	S199P	probably damaging	Het
Kdm1b	G	A	13: 47,077,486	G663D	probably damaging	Het
Lama1	A	G	17: 67,745,893	D407G	possibly damaging	Het
Macf1	T	C	4: 123,511,220	K391R	probably damaging	Het
Magi3	A	T	3: 104,105,791	S127T	probably damaging	Het
Map2	A	T	1: 66,438,796	D1759V	probably damaging	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Myrfl	T	C	10: 116,822,711	D447G	probably damaging	Het
Ndufb7	A	G	8: 83,571,465		probably benign	Het
Nt5e	T	A	9: 88,363,581	N301K	probably benign	Het
Olfr944	T	A	9: 39,218,114	Y252*	probably null	Het
Olfr960	A	T	9: 39,623,560	T146S	possibly damaging	Het
Pcdh18	A	G	3: 49,754,856	V670A	probably benign	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Ric3	G	C	7: 109,038,723	S274R	probably benign	Het
Rimbp3	A	G	16: 17,213,331	T1540A	probably damaging	Het
Rnf165	A	G	18: 77,462,912	S107P	probably damaging	Het
Rp1l1	A	T	14: 64,031,356	M1464L	probably benign	Het
Slc41a3	A	G	6: 90,626,417	Y140C	probably damaging	Het
Ssb	A	T	2: 69,866,237	E38D	possibly damaging	Het
Syt14	A	T	1: 193,026,984	I16N	probably damaging	Het
Tet3	T	C	6: 83,375,896	T973A	probably damaging	Het
Tial1	T	C	7: 128,443,968		probably benign	Het
Tnfrsf1a	A	G	6: 125,360,712	T89A	possibly damaging	Het
Trpv5	T	C	6: 41,675,945	Y98C	possibly damaging	Het
Ylpm1	T	A	12: 85,015,493	S265T	probably damaging	Het
Ylpm1	A	G	12: 85,042,239	D1006G	probably damaging	Het

Other mutations in Pcdh10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00863:Pcdh10	APN	3	45380302	missense	probably damaging	1.00
IGL01115:Pcdh10	APN	3	45392775	missense	probably damaging	1.00
IGL01535:Pcdh10	APN	3	45379643	missense	probably damaging	1.00
IGL01600:Pcdh10	APN	3	45379487	missense	probably damaging	0.98
IGL01625:Pcdh10	APN	3	45379397	missense	probably damaging	0.99
IGL01966:Pcdh10	APN	3	45380298	missense	probably benign	0.05
IGL02232:Pcdh10	APN	3	45380942	missense	probably benign	0.00
IGL02490:Pcdh10	APN	3	45380487	missense	probably damaging	1.00
IGL02890:Pcdh10	APN	3	45392617	missense	probably damaging	1.00
IGL02976:Pcdh10	APN	3	45380013	missense	possibly damaging	0.92
IGL02997:Pcdh10	APN	3	45379362	missense	probably damaging	1.00
IGL03006:Pcdh10	APN	3	45379502	missense	probably damaging	0.99
IGL03385:Pcdh10	APN	3	45381512	missense	possibly damaging	0.77
R0025:Pcdh10	UTSW	3	45380499	missense	possibly damaging	0.93
R0157:Pcdh10	UTSW	3	45379701	missense	probably damaging	1.00
R0372:Pcdh10	UTSW	3	45379497	missense	probably damaging	1.00
R0652:Pcdh10	UTSW	3	45379764	missense	probably damaging	1.00
R0760:Pcdh10	UTSW	3	45380570	missense	probably benign	0.19
R0976:Pcdh10	UTSW	3	45380801	missense	probably damaging	1.00
R1307:Pcdh10	UTSW	3	45381879	missense	probably benign	0.00
R1466:Pcdh10	UTSW	3	45379974	missense	probably damaging	1.00
R1466:Pcdh10	UTSW	3	45379974	missense	probably damaging	1.00
R1510:Pcdh10	UTSW	3	45379403	missense	probably damaging	1.00
R1619:Pcdh10	UTSW	3	45380312	missense	possibly damaging	0.94
R1678:Pcdh10	UTSW	3	45381881	nonsense	probably null
R1687:Pcdh10	UTSW	3	45380015	missense	probably damaging	1.00
R1750:Pcdh10	UTSW	3	45381881	nonsense	probably null
R1751:Pcdh10	UTSW	3	45384177	missense	probably damaging	1.00
R1767:Pcdh10	UTSW	3	45384177	missense	probably damaging	1.00
R1857:Pcdh10	UTSW	3	45379937	missense	possibly damaging	0.86
R2086:Pcdh10	UTSW	3	45380471	missense	probably damaging	0.98
R3960:Pcdh10	UTSW	3	45379314	missense	probably benign
R4083:Pcdh10	UTSW	3	45392707	missense	probably damaging	1.00
R4084:Pcdh10	UTSW	3	45392707	missense	probably damaging	1.00
R4112:Pcdh10	UTSW	3	45381620	missense	probably damaging	1.00
R4754:Pcdh10	UTSW	3	45380637	missense	probably damaging	0.99
R4946:Pcdh10	UTSW	3	45379482	missense	probably damaging	1.00
R5224:Pcdh10	UTSW	3	45392814	missense	probably damaging	0.99
R5233:Pcdh10	UTSW	3	45384191	missense	probably damaging	1.00
R5261:Pcdh10	UTSW	3	45381812	missense	probably damaging	1.00
R5429:Pcdh10	UTSW	3	45384200	missense	probably benign	0.00
R5488:Pcdh10	UTSW	3	45381368	missense	probably damaging	1.00
R5558:Pcdh10	UTSW	3	45384168	missense	probably damaging	1.00
R5784:Pcdh10	UTSW	3	45380640	missense	probably damaging	1.00
R5815:Pcdh10	UTSW	3	45392721	missense	probably benign	0.04
R6283:Pcdh10	UTSW	3	45381554	missense	possibly damaging	0.46
R6396:Pcdh10	UTSW	3	45380060	missense	possibly damaging	0.46
R6703:Pcdh10	UTSW	3	45381299	missense	possibly damaging	0.87
R6756:Pcdh10	UTSW	3	45380106	missense	possibly damaging	0.80
R6968:Pcdh10	UTSW	3	45379542	missense	probably damaging	1.00
R7463:Pcdh10	UTSW	3	45383572	missense	possibly damaging	0.59
R7574:Pcdh10	UTSW	3	45381375	missense	possibly damaging	0.92
R7691:Pcdh10	UTSW	3	45381197	missense	probably damaging	1.00
R7795:Pcdh10	UTSW	3	45380222	missense	probably benign	0.09
R8057:Pcdh10	UTSW	3	45379259	missense	probably benign	0.00
R8082:Pcdh10	UTSW	3	45381744	missense	probably damaging	1.00
R8302:Pcdh10	UTSW	3	45381498	missense	probably damaging	0.99
R8411:Pcdh10	UTSW	3	45379539	missense	probably damaging	1.00
R8555:Pcdh10	UTSW	3	45379595	missense	probably benign	0.41
X0013:Pcdh10	UTSW	3	45379566	missense	probably damaging	1.00
Z1177:Pcdh10	UTSW	3	45381729	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ATCATGTTGGTGCAGAGCGC -3'
(R):5'- GTGGAGTGCAGTCAGAACAC -3'

Sequencing Primer
(F):5'- GAGGCTTCGGTTCCCATCAC -3'
(R):5'- GGTGATAAAAGGTGACCCCCAATC -3'

Posted On

2016-06-21