Mutagenetix > Incidental Mutations

Incidental Mutation 'R5039:Trpv5'

List |< first << previous [record 51 of 53] next >> last >|

395695

Institutional Source

Beutler Lab

Gene Symbol

Trpv5

Ensembl Gene

ENSMUSG00000036899

Gene Name

transient receptor potential cation channel, subfamily V, member 5

Synonyms

ECaC1, CaT2

MMRRC Submission

042629-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R5039 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41652173-41680769 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 41675945 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 98 (Y98C)

Ref Sequence

ENSEMBL: ENSMUSP00000141421 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031901] [ENSMUST00000193503]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031901
AA Change: Y98C

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000031901
Gene: ENSMUSG00000036899
AA Change: Y98C

Domain	Start	End	E-Value	Type
Blast:ANK	38	68	1e-7	BLAST
ANK	72	102	2.3e0	SMART
ANK	110	139	4.56e-4	SMART
ANK	156	185	1.85e-4	SMART
Blast:ANK	189	217	3e-10	BLAST
ANK	232	261	3.07e2	SMART
Pfam:Ion_trans	321	583	1.8e-19	PFAM
low complexity region	676	691	N/A	INTRINSIC
low complexity region	708	719	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193503
AA Change: Y98C

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141421
Gene: ENSMUSG00000036899
AA Change: Y98C

Domain	Start	End	E-Value	Type
Blast:ANK	38	68	1e-7	BLAST
ANK	72	102	1.5e-2	SMART
ANK	110	139	2.8e-6	SMART
ANK	156	185	1.2e-6	SMART
Blast:ANK	189	217	4e-10	BLAST
transmembrane domain	274	296	N/A	INTRINSIC
Pfam:Ion_trans	335	522	2.7e-12	PFAM
low complexity region	627	642	N/A	INTRINSIC
low complexity region	659	670	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the transient receptor family and the TrpV subfamily. The calcium-selective channel encoded by this gene has 6 transmembrane-spanning domains, multiple potential phosphorylation sites, an N-linked glycosylation site, and 5 ANK repeats. This protein forms homotetramers or heterotetramers and is activated by a low internal calcium level. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit increased calcium excretion and reduced bone thickenss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	C	17: 33,067,760	C23G	probably damaging	Het
Abcg4	G	A	9: 44,281,566	A161V	probably damaging	Het
Anapc2	T	C	2: 25,274,796	I64T	possibly damaging	Het
Arfgef1	T	C	1: 10,199,736	D396G	probably benign	Het
Axl	C	T	7: 25,785,915	V163M	probably damaging	Het
Blm	G	A	7: 80,505,873	P353S	possibly damaging	Het
Btaf1	T	C	19: 36,990,762	Y1116H	probably benign	Het
Ccdc18	T	A	5: 108,158,648		probably null	Het
Ccdc87	T	C	19: 4,840,401		probably null	Het
Cdhr1	T	C	14: 37,079,643	N781S	probably benign	Het
Ctr9	C	A	7: 111,042,857	H297Q	probably benign	Het
Cyp2c55	A	G	19: 39,038,143	D398G	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dnmt3l	T	C	10: 78,052,900		probably null	Het
Dock4	C	A	12: 40,817,746	N1440K	probably damaging	Het
Etnk1	T	A	6: 143,195,317		probably null	Het
Fam120a	A	T	13: 48,910,250		probably null	Het
Fanca	T	C	8: 123,284,046	D908G	probably benign	Het
Gm17535	T	A	9: 3,035,786	L218H	probably benign	Het
Gm3633	A	C	14: 42,639,204	N42K	possibly damaging	Het
Gm4781	C	A	10: 100,396,989		noncoding transcript	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Gpr139	A	G	7: 119,144,942	V140A	probably benign	Het
Ighv1-62-3	G	T	12: 115,461,394	T13K	probably benign	Het
Itgb2l	T	C	16: 96,425,005	T629A	possibly damaging	Het
Kcnb2	T	C	1: 15,709,500	S199P	probably damaging	Het
Kdm1b	G	A	13: 47,077,486	G663D	probably damaging	Het
Lama1	A	G	17: 67,745,893	D407G	possibly damaging	Het
Macf1	T	C	4: 123,511,220	K391R	probably damaging	Het
Magi3	A	T	3: 104,105,791	S127T	probably damaging	Het
Map2	A	T	1: 66,438,796	D1759V	probably damaging	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Myrfl	T	C	10: 116,822,711	D447G	probably damaging	Het
Ndufb7	A	G	8: 83,571,465		probably benign	Het
Nt5e	T	A	9: 88,363,581	N301K	probably benign	Het
Olfr944	T	A	9: 39,218,114	Y252*	probably null	Het
Olfr960	A	T	9: 39,623,560	T146S	possibly damaging	Het
Pcdh10	A	G	3: 45,381,861	N870S	probably damaging	Het
Pcdh18	A	G	3: 49,754,856	V670A	probably benign	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Ric3	G	C	7: 109,038,723	S274R	probably benign	Het
Rimbp3	A	G	16: 17,213,331	T1540A	probably damaging	Het
Rnf165	A	G	18: 77,462,912	S107P	probably damaging	Het
Rp1l1	A	T	14: 64,031,356	M1464L	probably benign	Het
Slc41a3	A	G	6: 90,626,417	Y140C	probably damaging	Het
Ssb	A	T	2: 69,866,237	E38D	possibly damaging	Het
Syt14	A	T	1: 193,026,984	I16N	probably damaging	Het
Tet3	T	C	6: 83,375,896	T973A	probably damaging	Het
Tial1	T	C	7: 128,443,968		probably benign	Het
Tnfrsf1a	A	G	6: 125,360,712	T89A	possibly damaging	Het
Ylpm1	T	A	12: 85,015,493	S265T	probably damaging	Het
Ylpm1	A	G	12: 85,042,239	D1006G	probably damaging	Het

Other mutations in Trpv5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01349:Trpv5	APN	6	41675375	missense	possibly damaging	0.87
IGL01704:Trpv5	APN	6	41653258	missense	possibly damaging	0.88
IGL01860:Trpv5	APN	6	41660295	missense	probably damaging	1.00
IGL01950:Trpv5	APN	6	41675978	missense	probably benign	0.09
Firesign	UTSW	6	41658042	missense	probably damaging	1.00
gingame	UTSW	6	41670961	missense	probably damaging	1.00
R0515:Trpv5	UTSW	6	41674211	intron	probably benign
R1581:Trpv5	UTSW	6	41653140	missense	probably damaging	1.00
R1633:Trpv5	UTSW	6	41675920	nonsense	probably null
R1658:Trpv5	UTSW	6	41674282	missense	probably damaging	1.00
R1677:Trpv5	UTSW	6	41657797	missense	probably benign	0.44
R1955:Trpv5	UTSW	6	41657937	missense	probably damaging	1.00
R2008:Trpv5	UTSW	6	41659728	critical splice acceptor site	probably null
R2331:Trpv5	UTSW	6	41659968	missense	probably damaging	1.00
R2519:Trpv5	UTSW	6	41674350	missense	probably damaging	0.99
R2973:Trpv5	UTSW	6	41653231	missense	possibly damaging	0.81
R2974:Trpv5	UTSW	6	41653231	missense	possibly damaging	0.81
R3877:Trpv5	UTSW	6	41660343	missense	probably benign	0.10
R3923:Trpv5	UTSW	6	41653249	missense	probably benign	0.00
R4056:Trpv5	UTSW	6	41659705	missense	probably damaging	1.00
R4396:Trpv5	UTSW	6	41657896	missense	probably benign	0.00
R4757:Trpv5	UTSW	6	41653214	missense	probably damaging	0.98
R5013:Trpv5	UTSW	6	41659713	missense	probably damaging	1.00
R5330:Trpv5	UTSW	6	41660332	missense	probably benign	0.06
R5331:Trpv5	UTSW	6	41660332	missense	probably benign	0.06
R6270:Trpv5	UTSW	6	41674359	missense	possibly damaging	0.94
R6405:Trpv5	UTSW	6	41674668	missense	probably damaging	1.00
R6575:Trpv5	UTSW	6	41675969	missense	probably benign
R6669:Trpv5	UTSW	6	41658042	missense	probably damaging	1.00
R6681:Trpv5	UTSW	6	41653354	missense	probably damaging	0.97
R6817:Trpv5	UTSW	6	41658007	missense	possibly damaging	0.65
R7021:Trpv5	UTSW	6	41653270	missense	probably benign	0.00
R7069:Trpv5	UTSW	6	41675960	missense	possibly damaging	0.94
R7161:Trpv5	UTSW	6	41660536	nonsense	probably null
R7241:Trpv5	UTSW	6	41675308	nonsense	probably null
R7505:Trpv5	UTSW	6	41674656	missense	probably damaging	0.99
R7806:Trpv5	UTSW	6	41674933	missense	probably damaging	0.99
R8060:Trpv5	UTSW	6	41674531	nonsense	probably null
R8407:Trpv5	UTSW	6	41675338	missense	probably benign	0.02
R8428:Trpv5	UTSW	6	41653248	missense	possibly damaging	0.48
R8435:Trpv5	UTSW	6	41670893	missense	probably damaging	1.00
Z1177:Trpv5	UTSW	6	41674321	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAATGGTCTGAGGGGCTCTGAG -3'
(R):5'- AACTGCTGAGGTGCTTCTGG -3'

Sequencing Primer
(F):5'- TCTGAGGGGCTCTGAGGAGAC -3'
(R):5'- CTGGAGCTAGGACTCTTTGGAAG -3'

Posted On

2016-06-21