Incidental Mutation 'R5039:Slc41a3'
ID395697
Institutional Source Beutler Lab
Gene Symbol Slc41a3
Ensembl Gene ENSMUSG00000030089
Gene Namesolute carrier family 41, member 3
Synonyms1010001P06Rik, SLC41A1-L2
MMRRC Submission 042629-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5039 (G1)
Quality Score169
Status Validated
Chromosome6
Chromosomal Location90604725-90646412 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90626417 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 140 (Y140C)
Ref Sequence ENSEMBL: ENSMUSP00000037473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032177] [ENSMUST00000044019]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032177
AA Change: Y114C

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032177
Gene: ENSMUSG00000030089
AA Change: Y114C

DomainStartEndE-ValueType
transmembrane domain 42 64 N/A INTRINSIC
Pfam:MgtE 80 214 3.4e-27 PFAM
transmembrane domain 224 246 N/A INTRINSIC
transmembrane domain 258 277 N/A INTRINSIC
Pfam:MgtE 293 437 9.8e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000044019
AA Change: Y140C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037473
Gene: ENSMUSG00000030089
AA Change: Y140C

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:MgtE 106 240 2.5e-27 PFAM
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 284 303 N/A INTRINSIC
Pfam:MgtE 319 463 7.2e-27 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered magnesium ion homeostasis including hypomagnesemia. A subset of homozygotes develop severe unilateral hydronephrosis when fed a low magnesium diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,760 C23G probably damaging Het
Abcg4 G A 9: 44,281,566 A161V probably damaging Het
Anapc2 T C 2: 25,274,796 I64T possibly damaging Het
Arfgef1 T C 1: 10,199,736 D396G probably benign Het
Axl C T 7: 25,785,915 V163M probably damaging Het
Blm G A 7: 80,505,873 P353S possibly damaging Het
Btaf1 T C 19: 36,990,762 Y1116H probably benign Het
Ccdc18 T A 5: 108,158,648 probably null Het
Ccdc87 T C 19: 4,840,401 probably null Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ctr9 C A 7: 111,042,857 H297Q probably benign Het
Cyp2c55 A G 19: 39,038,143 D398G probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnmt3l T C 10: 78,052,900 probably null Het
Dock4 C A 12: 40,817,746 N1440K probably damaging Het
Etnk1 T A 6: 143,195,317 probably null Het
Fam120a A T 13: 48,910,250 probably null Het
Fanca T C 8: 123,284,046 D908G probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3633 A C 14: 42,639,204 N42K possibly damaging Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gpr139 A G 7: 119,144,942 V140A probably benign Het
Ighv1-62-3 G T 12: 115,461,394 T13K probably benign Het
Itgb2l T C 16: 96,425,005 T629A possibly damaging Het
Kcnb2 T C 1: 15,709,500 S199P probably damaging Het
Kdm1b G A 13: 47,077,486 G663D probably damaging Het
Lama1 A G 17: 67,745,893 D407G possibly damaging Het
Macf1 T C 4: 123,511,220 K391R probably damaging Het
Magi3 A T 3: 104,105,791 S127T probably damaging Het
Map2 A T 1: 66,438,796 D1759V probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myrfl T C 10: 116,822,711 D447G probably damaging Het
Ndufb7 A G 8: 83,571,465 probably benign Het
Nt5e T A 9: 88,363,581 N301K probably benign Het
Olfr944 T A 9: 39,218,114 Y252* probably null Het
Olfr960 A T 9: 39,623,560 T146S possibly damaging Het
Pcdh10 A G 3: 45,381,861 N870S probably damaging Het
Pcdh18 A G 3: 49,754,856 V670A probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ric3 G C 7: 109,038,723 S274R probably benign Het
Rimbp3 A G 16: 17,213,331 T1540A probably damaging Het
Rnf165 A G 18: 77,462,912 S107P probably damaging Het
Rp1l1 A T 14: 64,031,356 M1464L probably benign Het
Ssb A T 2: 69,866,237 E38D possibly damaging Het
Syt14 A T 1: 193,026,984 I16N probably damaging Het
Tet3 T C 6: 83,375,896 T973A probably damaging Het
Tial1 T C 7: 128,443,968 probably benign Het
Tnfrsf1a A G 6: 125,360,712 T89A possibly damaging Het
Trpv5 T C 6: 41,675,945 Y98C possibly damaging Het
Ylpm1 T A 12: 85,015,493 S265T probably damaging Het
Ylpm1 A G 12: 85,042,239 D1006G probably damaging Het
Other mutations in Slc41a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Slc41a3 APN 6 90645714 missense probably damaging 1.00
IGL02583:Slc41a3 APN 6 90644171 missense probably damaging 0.99
PIT4378001:Slc41a3 UTSW 6 90640909 missense probably benign 0.36
R1076:Slc41a3 UTSW 6 90644160 missense probably benign
R1529:Slc41a3 UTSW 6 90644216 missense probably damaging 0.99
R1591:Slc41a3 UTSW 6 90633695 missense probably benign 0.02
R1985:Slc41a3 UTSW 6 90642228 missense probably damaging 1.00
R2133:Slc41a3 UTSW 6 90626381 missense probably damaging 0.99
R2308:Slc41a3 UTSW 6 90612120 missense possibly damaging 0.51
R2384:Slc41a3 UTSW 6 90626411 missense probably damaging 0.98
R2697:Slc41a3 UTSW 6 90642320 missense possibly damaging 0.81
R3237:Slc41a3 UTSW 6 90636865 missense probably benign 0.10
R4287:Slc41a3 UTSW 6 90640922 missense probably benign 0.00
R4394:Slc41a3 UTSW 6 90635330 missense probably damaging 1.00
R5195:Slc41a3 UTSW 6 90633671 missense probably damaging 1.00
R5293:Slc41a3 UTSW 6 90626444 missense probably damaging 0.99
R5338:Slc41a3 UTSW 6 90612171 missense possibly damaging 0.93
R5608:Slc41a3 UTSW 6 90640907 missense probably benign 0.06
R5681:Slc41a3 UTSW 6 90640946 missense probably damaging 0.99
R5783:Slc41a3 UTSW 6 90619542 missense probably benign 0.06
R6648:Slc41a3 UTSW 6 90619508 missense probably damaging 0.99
R7867:Slc41a3 UTSW 6 90640927 missense probably damaging 0.96
X0025:Slc41a3 UTSW 6 90635322 missense probably damaging 1.00
Z1177:Slc41a3 UTSW 6 90619573 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAAGTAGGTCACCATCTAGAAAGC -3'
(R):5'- TCACTATGCCACAGATACCGTC -3'

Sequencing Primer
(F):5'- GGTCACCATCTAGAAAGCTTAATAG -3'
(R):5'- GGTGGCCACATAGACAACTGTC -3'
Posted On2016-06-21