Incidental Mutation 'R5039:Etnk1'
ID395698
Institutional Source Beutler Lab
Gene Symbol Etnk1
Ensembl Gene ENSMUSG00000030275
Gene Nameethanolamine kinase 1
SynonymsEKI1, D6Ertd3e, 4930555L11Rik, 1110061E11Rik
MMRRC Submission 042629-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5039 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location143167221-143232307 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 143195317 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032413] [ENSMUST00000204947] [ENSMUST00000205256]
Predicted Effect probably null
Transcript: ENSMUST00000032413
SMART Domains Protein: ENSMUSP00000032413
Gene: ENSMUSG00000030275

DomainStartEndE-ValueType
Pfam:APH 50 296 1.8e-16 PFAM
Pfam:Choline_kinase 71 276 2.8e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203341
Predicted Effect probably null
Transcript: ENSMUST00000204947
SMART Domains Protein: ENSMUSP00000145041
Gene: ENSMUSG00000030275

DomainStartEndE-ValueType
Pfam:APH 50 296 2.3e-14 PFAM
Pfam:Choline_kinase 71 276 2.7e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205256
SMART Domains Protein: ENSMUSP00000144903
Gene: ENSMUSG00000030275

DomainStartEndE-ValueType
Pfam:APH 50 296 1.7e-14 PFAM
Pfam:Choline_kinase 71 276 2.1e-61 PFAM
Pfam:EcKinase 184 260 3e-4 PFAM
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ethanolamine kinase, which functions in the first committed step of the phosphatidylethanolamine synthesis pathway. This cytosolic enzyme is specific for ethanolamine and exhibits negligible kinase activity on choline. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,760 C23G probably damaging Het
Abcg4 G A 9: 44,281,566 A161V probably damaging Het
Anapc2 T C 2: 25,274,796 I64T possibly damaging Het
Arfgef1 T C 1: 10,199,736 D396G probably benign Het
Axl C T 7: 25,785,915 V163M probably damaging Het
Blm G A 7: 80,505,873 P353S possibly damaging Het
Btaf1 T C 19: 36,990,762 Y1116H probably benign Het
Ccdc18 T A 5: 108,158,648 probably null Het
Ccdc87 T C 19: 4,840,401 probably null Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ctr9 C A 7: 111,042,857 H297Q probably benign Het
Cyp2c55 A G 19: 39,038,143 D398G probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnmt3l T C 10: 78,052,900 probably null Het
Dock4 C A 12: 40,817,746 N1440K probably damaging Het
Fam120a A T 13: 48,910,250 probably null Het
Fanca T C 8: 123,284,046 D908G probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3633 A C 14: 42,639,204 N42K possibly damaging Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gpr139 A G 7: 119,144,942 V140A probably benign Het
Ighv1-62-3 G T 12: 115,461,394 T13K probably benign Het
Itgb2l T C 16: 96,425,005 T629A possibly damaging Het
Kcnb2 T C 1: 15,709,500 S199P probably damaging Het
Kdm1b G A 13: 47,077,486 G663D probably damaging Het
Lama1 A G 17: 67,745,893 D407G possibly damaging Het
Macf1 T C 4: 123,511,220 K391R probably damaging Het
Magi3 A T 3: 104,105,791 S127T probably damaging Het
Map2 A T 1: 66,438,796 D1759V probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myrfl T C 10: 116,822,711 D447G probably damaging Het
Ndufb7 A G 8: 83,571,465 probably benign Het
Nt5e T A 9: 88,363,581 N301K probably benign Het
Olfr944 T A 9: 39,218,114 Y252* probably null Het
Olfr960 A T 9: 39,623,560 T146S possibly damaging Het
Pcdh10 A G 3: 45,381,861 N870S probably damaging Het
Pcdh18 A G 3: 49,754,856 V670A probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ric3 G C 7: 109,038,723 S274R probably benign Het
Rimbp3 A G 16: 17,213,331 T1540A probably damaging Het
Rnf165 A G 18: 77,462,912 S107P probably damaging Het
Rp1l1 A T 14: 64,031,356 M1464L probably benign Het
Slc41a3 A G 6: 90,626,417 Y140C probably damaging Het
Ssb A T 2: 69,866,237 E38D possibly damaging Het
Syt14 A T 1: 193,026,984 I16N probably damaging Het
Tet3 T C 6: 83,375,896 T973A probably damaging Het
Tial1 T C 7: 128,443,968 probably benign Het
Tnfrsf1a A G 6: 125,360,712 T89A possibly damaging Het
Trpv5 T C 6: 41,675,945 Y98C possibly damaging Het
Ylpm1 T A 12: 85,015,493 S265T probably damaging Het
Ylpm1 A G 12: 85,042,239 D1006G probably damaging Het
Other mutations in Etnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Etnk1 APN 6 143180666 missense probably damaging 1.00
R0415:Etnk1 UTSW 6 143180774 missense probably damaging 1.00
R0928:Etnk1 UTSW 6 143184703 missense probably benign 0.00
R1542:Etnk1 UTSW 6 143180641 missense probably benign 0.00
R4648:Etnk1 UTSW 6 143195274 missense probably damaging 1.00
R4744:Etnk1 UTSW 6 143186593 missense probably damaging 1.00
R4823:Etnk1 UTSW 6 143167638 critical splice donor site probably null
R5909:Etnk1 UTSW 6 143197438 missense probably benign 0.02
R6207:Etnk1 UTSW 6 143180798 missense probably damaging 0.99
R6743:Etnk1 UTSW 6 143180617 missense possibly damaging 0.68
R7009:Etnk1 UTSW 6 143203154 critical splice donor site probably null
X0026:Etnk1 UTSW 6 143180726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCCTGTGTTGTCTCAGAAG -3'
(R):5'- AGATTCTCCCCTTCTAGTGCAG -3'

Sequencing Primer
(F):5'- GTTGTCTCAGAAGTGCATGTAACC -3'
(R):5'- CAGTATTTTCTGGTGGCAATGAG -3'
Posted On2016-06-21