Mutagenetix > Incidental Mutation

Incidental Mutation 'R5039:Blm'

395700

Institutional Source

Beutler Lab

Gene Symbol

Blm

Ensembl Gene

ENSMUSG00000030528

Gene Name

Bloom syndrome, RecQ like helicase

Synonyms

MMRRC Submission

042629-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5039 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80454733-80535119 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 80505873 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 353 (P353S)

Ref Sequence

ENSEMBL: ENSMUSP00000127995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]

AlphaFold

O88700

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081314
AA Change: P350S

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528
AA Change: P350S

Domain	Start	End	E-Value	Type
low complexity region	46	54	N/A	INTRINSIC
low complexity region	118	132	N/A	INTRINSIC
low complexity region	142	169	N/A	INTRINSIC
low complexity region	219	231	N/A	INTRINSIC
low complexity region	318	335	N/A	INTRINSIC
Pfam:BDHCT	376	416	5.5e-27	PFAM
low complexity region	557	574	N/A	INTRINSIC
DEXDc	672	873	1.59e-29	SMART
HELICc	910	992	1.29e-24	SMART
RQC	1084	1198	1.43e-15	SMART
HRDC	1217	1297	9.4e-20	SMART
low complexity region	1357	1371	N/A	INTRINSIC
low complexity region	1378	1392	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166096

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170315
AA Change: P353S

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528
AA Change: P353S

Domain	Start	End	E-Value	Type
Pfam:BLM_N	4	375	1.1e-161	PFAM
Pfam:BDHCT	380	419	6.4e-25	PFAM
Pfam:BDHCT_assoc	433	658	8.8e-108	PFAM
DEXDc	675	876	1.59e-29	SMART
HELICc	913	995	1.29e-24	SMART
Pfam:RecQ_Zn_bind	1006	1078	1.5e-19	PFAM
RQC	1087	1201	1.43e-15	SMART
HRDC	1220	1300	9.4e-20	SMART
low complexity region	1360	1374	N/A	INTRINSIC
low complexity region	1381	1395	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205263

Meta Mutation Damage Score

0.0870

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	C	17: 33,067,760	C23G	probably damaging	Het
Abcg4	G	A	9: 44,281,566	A161V	probably damaging	Het
Anapc2	T	C	2: 25,274,796	I64T	possibly damaging	Het
Arfgef1	T	C	1: 10,199,736	D396G	probably benign	Het
Axl	C	T	7: 25,785,915	V163M	probably damaging	Het
Btaf1	T	C	19: 36,990,762	Y1116H	probably benign	Het
Ccdc18	T	A	5: 108,158,648		probably null	Het
Ccdc87	T	C	19: 4,840,401		probably null	Het
Cdhr1	T	C	14: 37,079,643	N781S	probably benign	Het
Ctr9	C	A	7: 111,042,857	H297Q	probably benign	Het
Cyp2c55	A	G	19: 39,038,143	D398G	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dnmt3l	T	C	10: 78,052,900		probably null	Het
Dock4	C	A	12: 40,817,746	N1440K	probably damaging	Het
Etnk1	T	A	6: 143,195,317		probably null	Het
Fam120a	A	T	13: 48,910,250		probably null	Het
Fanca	T	C	8: 123,284,046	D908G	probably benign	Het
Gm17535	T	A	9: 3,035,786	L218H	probably benign	Het
Gm3633	A	C	14: 42,639,204	N42K	possibly damaging	Het
Gm4781	C	A	10: 100,396,989		noncoding transcript	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Gpr139	A	G	7: 119,144,942	V140A	probably benign	Het
Ighv1-62-3	G	T	12: 115,461,394	T13K	probably benign	Het
Itgb2l	T	C	16: 96,425,005	T629A	possibly damaging	Het
Kcnb2	T	C	1: 15,709,500	S199P	probably damaging	Het
Kdm1b	G	A	13: 47,077,486	G663D	probably damaging	Het
Lama1	A	G	17: 67,745,893	D407G	possibly damaging	Het
Macf1	T	C	4: 123,511,220	K391R	probably damaging	Het
Magi3	A	T	3: 104,105,791	S127T	probably damaging	Het
Map2	A	T	1: 66,438,796	D1759V	probably damaging	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Myrfl	T	C	10: 116,822,711	D447G	probably damaging	Het
Ndufb7	A	G	8: 83,571,465		probably benign	Het
Nt5e	T	A	9: 88,363,581	N301K	probably benign	Het
Olfr944	T	A	9: 39,218,114	Y252*	probably null	Het
Olfr960	A	T	9: 39,623,560	T146S	possibly damaging	Het
Pcdh10	A	G	3: 45,381,861	N870S	probably damaging	Het
Pcdh18	A	G	3: 49,754,856	V670A	probably benign	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Ric3	G	C	7: 109,038,723	S274R	probably benign	Het
Rimbp3	A	G	16: 17,213,331	T1540A	probably damaging	Het
Rnf165	A	G	18: 77,462,912	S107P	probably damaging	Het
Rp1l1	A	T	14: 64,031,356	M1464L	probably benign	Het
Slc41a3	A	G	6: 90,626,417	Y140C	probably damaging	Het
Ssb	A	T	2: 69,866,237	E38D	possibly damaging	Het
Syt14	A	T	1: 193,026,984	I16N	probably damaging	Het
Tet3	T	C	6: 83,375,896	T973A	probably damaging	Het
Tial1	T	C	7: 128,443,968		probably benign	Het
Tnfrsf1a	A	G	6: 125,360,712	T89A	possibly damaging	Het
Trpv5	T	C	6: 41,675,945	Y98C	possibly damaging	Het
Ylpm1	T	A	12: 85,015,493	S265T	probably damaging	Het
Ylpm1	A	G	12: 85,042,239	D1006G	probably damaging	Het

Other mutations in Blm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01531:Blm	APN	7	80474071	missense	probably damaging	1.00
IGL01658:Blm	APN	7	80463941	missense	probably damaging	0.98
IGL02048:Blm	APN	7	80502961	splice site	probably benign
IGL02060:Blm	APN	7	80514580	splice site	probably benign
IGL02063:Blm	APN	7	80509419	nonsense	probably null
IGL02102:Blm	APN	7	80469756	missense	probably damaging	1.00
IGL02420:Blm	APN	7	80496006	missense	probably damaging	1.00
IGL02452:Blm	APN	7	80503377	splice site	probably null
IGL02566:Blm	APN	7	80474196	missense	probably damaging	1.00
IGL03387:Blm	APN	7	80494147	missense	probably damaging	1.00
FR4304:Blm	UTSW	7	80463773	frame shift	probably null
FR4304:Blm	UTSW	7	80512919	small insertion	probably benign
FR4340:Blm	UTSW	7	80463767	unclassified	probably benign
FR4340:Blm	UTSW	7	80512907	small insertion	probably benign
FR4340:Blm	UTSW	7	80512910	small insertion	probably benign
FR4449:Blm	UTSW	7	80512908	small insertion	probably benign
FR4548:Blm	UTSW	7	80463769	frame shift	probably null
FR4589:Blm	UTSW	7	80463770	frame shift	probably null
FR4737:Blm	UTSW	7	80463771	frame shift	probably null
FR4737:Blm	UTSW	7	80463774	frame shift	probably null
FR4976:Blm	UTSW	7	80463767	unclassified	probably benign
FR4976:Blm	UTSW	7	80512907	small insertion	probably benign
R0133:Blm	UTSW	7	80502367	missense	possibly damaging	0.93
R0194:Blm	UTSW	7	80464946	unclassified	probably benign
R0526:Blm	UTSW	7	80505893	nonsense	probably null
R0673:Blm	UTSW	7	80499751	critical splice donor site	probably null
R0972:Blm	UTSW	7	80513370	missense	probably benign
R0980:Blm	UTSW	7	80499958	splice site	probably null
R1120:Blm	UTSW	7	80481466	missense	probably damaging	1.00
R1301:Blm	UTSW	7	80455417	nonsense	probably null
R1769:Blm	UTSW	7	80513370	missense	probably benign
R1866:Blm	UTSW	7	80494114	missense	probably benign	0.08
R1874:Blm	UTSW	7	80497418	missense	probably damaging	1.00
R1966:Blm	UTSW	7	80513186	missense	possibly damaging	0.86
R1991:Blm	UTSW	7	80505949	splice site	probably null
R2013:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2014:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2015:Blm	UTSW	7	80502399	missense	probably damaging	0.99
R2016:Blm	UTSW	7	80505926	missense	probably benign	0.26
R2103:Blm	UTSW	7	80505949	splice site	probably null
R2161:Blm	UTSW	7	80481370	splice site	probably null
R2215:Blm	UTSW	7	80499847	missense	possibly damaging	0.69
R3689:Blm	UTSW	7	80513079	missense	possibly damaging	0.56
R4049:Blm	UTSW	7	80502862	missense	probably benign	0.04
R4155:Blm	UTSW	7	80512904	small deletion	probably benign
R4695:Blm	UTSW	7	80494228	missense	probably damaging	1.00
R4774:Blm	UTSW	7	80463848	missense	probably damaging	1.00
R4833:Blm	UTSW	7	80466826	missense	probably benign
R4835:Blm	UTSW	7	80509546	missense	probably benign	0.41
R4994:Blm	UTSW	7	80458825	missense	probably benign	0.00
R5330:Blm	UTSW	7	80458936	missense	possibly damaging	0.73
R5375:Blm	UTSW	7	80513229	missense	probably benign	0.00
R5408:Blm	UTSW	7	80502622	missense	probably benign	0.01
R5574:Blm	UTSW	7	80499773	missense	probably damaging	1.00
R5606:Blm	UTSW	7	80460832	splice site	probably null
R5702:Blm	UTSW	7	80458927	missense	probably benign	0.13
R5809:Blm	UTSW	7	80464844	missense	probably damaging	1.00
R6114:Blm	UTSW	7	80513487	missense	probably damaging	1.00
R6157:Blm	UTSW	7	80512985	missense	probably benign	0.18
R6163:Blm	UTSW	7	80512904	small deletion	probably benign
R6254:Blm	UTSW	7	80480342	missense	probably benign	0.04
R6266:Blm	UTSW	7	80499940	missense	probably benign	0.03
R6364:Blm	UTSW	7	80494526	nonsense	probably null
R6446:Blm	UTSW	7	80512904	small deletion	probably benign
R6502:Blm	UTSW	7	80481475	missense	probably damaging	0.98
R6700:Blm	UTSW	7	80463850	missense	possibly damaging	0.91
R7002:Blm	UTSW	7	80469753	missense	probably benign	0.00
R7105:Blm	UTSW	7	80499768	missense	probably benign	0.44
R7320:Blm	UTSW	7	80455354	nonsense	probably null
R7465:Blm	UTSW	7	80513115	missense	probably benign	0.02
R7561:Blm	UTSW	7	80502528	missense	probably damaging	0.99
R8500:Blm	UTSW	7	80455284	missense	probably damaging	1.00
R8543:Blm	UTSW	7	80494216	missense	probably damaging	0.98
R8774-TAIL:Blm	UTSW	7	80512907	small insertion	probably benign
R8774-TAIL:Blm	UTSW	7	80512918	small insertion	probably benign
R8774-TAIL:Blm	UTSW	7	80512919	small insertion	probably benign
R8775-TAIL:Blm	UTSW	7	80512931	small insertion	probably benign
R8860:Blm	UTSW	7	80494528	missense	probably benign	0.30
R8928:Blm	UTSW	7	80512904	small deletion	probably benign
R9089:Blm	UTSW	7	80513119	missense	probably damaging	1.00
R9363:Blm	UTSW	7	80458915	missense	probably damaging	1.00
RF001:Blm	UTSW	7	80512903	small insertion	probably benign
RF001:Blm	UTSW	7	80512906	small insertion	probably benign
RF001:Blm	UTSW	7	80512927	small insertion	probably benign
RF002:Blm	UTSW	7	80512905	small insertion	probably benign
RF002:Blm	UTSW	7	80512927	small insertion	probably benign
RF007:Blm	UTSW	7	80512933	nonsense	probably null
RF016:Blm	UTSW	7	80512926	nonsense	probably null
RF018:Blm	UTSW	7	80512926	nonsense	probably null
RF027:Blm	UTSW	7	80512914	frame shift	probably null
RF028:Blm	UTSW	7	80512905	nonsense	probably null
RF031:Blm	UTSW	7	80512906	small insertion	probably benign
RF031:Blm	UTSW	7	80512923	small insertion	probably benign
RF032:Blm	UTSW	7	80512930	small insertion	probably benign
RF036:Blm	UTSW	7	80512914	nonsense	probably null
RF044:Blm	UTSW	7	80512930	small insertion	probably benign
RF053:Blm	UTSW	7	80512921	small insertion	probably benign
RF064:Blm	UTSW	7	80512923	nonsense	probably null
X0061:Blm	UTSW	7	80458850	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AGGAGTTGAATGATCTAAACGTCAC -3'
(R):5'- TCTCTTGGGACCAGAAGACG -3'

Sequencing Primer
(F):5'- ACGTCACTGTAATTGTAAAGAAGAC -3'
(R):5'- CTTGGCCATATAGCAAGTTCCAGG -3'

Posted On

2016-06-21