Incidental Mutation 'R5039:Ric3'
ID395701
Institutional Source Beutler Lab
Gene Symbol Ric3
Ensembl Gene ENSMUSG00000048330
Gene NameRIC3 acetylcholine receptor chaperone
Synonyms
MMRRC Submission 042629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5039 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location109034312-109083331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 109038723 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 274 (S274R)
Ref Sequence ENSEMBL: ENSMUSP00000112788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033341] [ENSMUST00000055993] [ENSMUST00000120876] [ENSMUST00000147580]
Predicted Effect probably benign
Transcript: ENSMUST00000033341
SMART Domains Protein: ENSMUSP00000033341
Gene: ENSMUSG00000031028

DomainStartEndE-ValueType
Pfam:Tub_N 29 237 2.5e-58 PFAM
Pfam:Tub 257 499 2.4e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055993
AA Change: S275R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056990
Gene: ENSMUSG00000048330
AA Change: S275R

DomainStartEndE-ValueType
Pfam:RIC3 15 165 1.2e-38 PFAM
low complexity region 256 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120876
AA Change: S274R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112788
Gene: ENSMUSG00000048330
AA Change: S274R

DomainStartEndE-ValueType
Pfam:RIC3 15 165 3.9e-52 PFAM
low complexity region 255 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147580
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the resistance to inhibitors of cholinesterase 3-like family which functions as a chaperone of specific 5-hydroxytryptamine type 3 receptor and nicotinic acetylcholine receptor subtypes. The encoded protein influences the folding and assembly of these receptor subunits in the endoplasmic reticulum and expression on the cell surface. This protein contains an N-terminal transmembrane domain, a proline-rich spacer, and a cytosolic C-terminal coiled-coil domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,760 C23G probably damaging Het
Abcg4 G A 9: 44,281,566 A161V probably damaging Het
Anapc2 T C 2: 25,274,796 I64T possibly damaging Het
Arfgef1 T C 1: 10,199,736 D396G probably benign Het
Axl C T 7: 25,785,915 V163M probably damaging Het
Blm G A 7: 80,505,873 P353S possibly damaging Het
Btaf1 T C 19: 36,990,762 Y1116H probably benign Het
Ccdc18 T A 5: 108,158,648 probably null Het
Ccdc87 T C 19: 4,840,401 probably null Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ctr9 C A 7: 111,042,857 H297Q probably benign Het
Cyp2c55 A G 19: 39,038,143 D398G probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnmt3l T C 10: 78,052,900 probably null Het
Dock4 C A 12: 40,817,746 N1440K probably damaging Het
Etnk1 T A 6: 143,195,317 probably null Het
Fam120a A T 13: 48,910,250 probably null Het
Fanca T C 8: 123,284,046 D908G probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3633 A C 14: 42,639,204 N42K possibly damaging Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gpr139 A G 7: 119,144,942 V140A probably benign Het
Ighv1-62-3 G T 12: 115,461,394 T13K probably benign Het
Itgb2l T C 16: 96,425,005 T629A possibly damaging Het
Kcnb2 T C 1: 15,709,500 S199P probably damaging Het
Kdm1b G A 13: 47,077,486 G663D probably damaging Het
Lama1 A G 17: 67,745,893 D407G possibly damaging Het
Macf1 T C 4: 123,511,220 K391R probably damaging Het
Magi3 A T 3: 104,105,791 S127T probably damaging Het
Map2 A T 1: 66,438,796 D1759V probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myrfl T C 10: 116,822,711 D447G probably damaging Het
Ndufb7 A G 8: 83,571,465 probably benign Het
Nt5e T A 9: 88,363,581 N301K probably benign Het
Olfr944 T A 9: 39,218,114 Y252* probably null Het
Olfr960 A T 9: 39,623,560 T146S possibly damaging Het
Pcdh10 A G 3: 45,381,861 N870S probably damaging Het
Pcdh18 A G 3: 49,754,856 V670A probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Rimbp3 A G 16: 17,213,331 T1540A probably damaging Het
Rnf165 A G 18: 77,462,912 S107P probably damaging Het
Rp1l1 A T 14: 64,031,356 M1464L probably benign Het
Slc41a3 A G 6: 90,626,417 Y140C probably damaging Het
Ssb A T 2: 69,866,237 E38D possibly damaging Het
Syt14 A T 1: 193,026,984 I16N probably damaging Het
Tet3 T C 6: 83,375,896 T973A probably damaging Het
Tial1 T C 7: 128,443,968 probably benign Het
Tnfrsf1a A G 6: 125,360,712 T89A possibly damaging Het
Trpv5 T C 6: 41,675,945 Y98C possibly damaging Het
Ylpm1 T A 12: 85,015,493 S265T probably damaging Het
Ylpm1 A G 12: 85,042,239 D1006G probably damaging Het
Other mutations in Ric3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Ric3 APN 7 109054412 missense probably damaging 1.00
IGL00942:Ric3 APN 7 109054413 missense probably damaging 1.00
IGL02318:Ric3 APN 7 109048080 missense probably damaging 1.00
IGL02868:Ric3 APN 7 109054419 missense probably damaging 1.00
IGL03012:Ric3 APN 7 109038718 missense probably benign
R0842:Ric3 UTSW 7 109038880 missense probably damaging 1.00
R2291:Ric3 UTSW 7 109038883 missense probably damaging 1.00
R2912:Ric3 UTSW 7 109054453 missense possibly damaging 0.87
R2913:Ric3 UTSW 7 109054453 missense possibly damaging 0.87
R3690:Ric3 UTSW 7 109038610 missense possibly damaging 0.89
R4587:Ric3 UTSW 7 109054363 critical splice donor site probably null
R5636:Ric3 UTSW 7 109038820 missense probably damaging 1.00
R6738:Ric3 UTSW 7 109048062 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCATTATCAGTGCTGACTCC -3'
(R):5'- CCTCTCTAGGTTACCCAGAAGAG -3'

Sequencing Primer
(F):5'- AAAGTCCTGGGGCAAGTTTTCC -3'
(R):5'- TAGGTTACCCAGAAGAGACTTATCC -3'
Posted On2016-06-21