Incidental Mutation 'R5039:Gpr139'
ID395703
Institutional Source Beutler Lab
Gene Symbol Gpr139
Ensembl Gene ENSMUSG00000066197
Gene NameG protein-coupled receptor 139
SynonymsLOC209776, GPRg1
MMRRC Submission 042629-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5039 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119140747-119184603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119144942 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 140 (V140A)
Ref Sequence ENSEMBL: ENSMUSP00000081700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084650]
Predicted Effect probably benign
Transcript: ENSMUST00000084650
AA Change: V140A

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081700
Gene: ENSMUSG00000066197
AA Change: V140A

DomainStartEndE-ValueType
Pfam:7tm_1 35 277 2.9e-18 PFAM
Meta Mutation Damage Score 0.1862 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhodopsin family of G-protein-coupled receptors. The encoded protein is almost exclusively expressed in the central nervous system. L-tryptophan and L-phenylalanine may act as the physiologic ligands of the encoded protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,760 C23G probably damaging Het
Abcg4 G A 9: 44,281,566 A161V probably damaging Het
Anapc2 T C 2: 25,274,796 I64T possibly damaging Het
Arfgef1 T C 1: 10,199,736 D396G probably benign Het
Axl C T 7: 25,785,915 V163M probably damaging Het
Blm G A 7: 80,505,873 P353S possibly damaging Het
Btaf1 T C 19: 36,990,762 Y1116H probably benign Het
Ccdc18 T A 5: 108,158,648 probably null Het
Ccdc87 T C 19: 4,840,401 probably null Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ctr9 C A 7: 111,042,857 H297Q probably benign Het
Cyp2c55 A G 19: 39,038,143 D398G probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnmt3l T C 10: 78,052,900 probably null Het
Dock4 C A 12: 40,817,746 N1440K probably damaging Het
Etnk1 T A 6: 143,195,317 probably null Het
Fam120a A T 13: 48,910,250 probably null Het
Fanca T C 8: 123,284,046 D908G probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3633 A C 14: 42,639,204 N42K possibly damaging Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Ighv1-62-3 G T 12: 115,461,394 T13K probably benign Het
Itgb2l T C 16: 96,425,005 T629A possibly damaging Het
Kcnb2 T C 1: 15,709,500 S199P probably damaging Het
Kdm1b G A 13: 47,077,486 G663D probably damaging Het
Lama1 A G 17: 67,745,893 D407G possibly damaging Het
Macf1 T C 4: 123,511,220 K391R probably damaging Het
Magi3 A T 3: 104,105,791 S127T probably damaging Het
Map2 A T 1: 66,438,796 D1759V probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myrfl T C 10: 116,822,711 D447G probably damaging Het
Ndufb7 A G 8: 83,571,465 probably benign Het
Nt5e T A 9: 88,363,581 N301K probably benign Het
Olfr944 T A 9: 39,218,114 Y252* probably null Het
Olfr960 A T 9: 39,623,560 T146S possibly damaging Het
Pcdh10 A G 3: 45,381,861 N870S probably damaging Het
Pcdh18 A G 3: 49,754,856 V670A probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ric3 G C 7: 109,038,723 S274R probably benign Het
Rimbp3 A G 16: 17,213,331 T1540A probably damaging Het
Rnf165 A G 18: 77,462,912 S107P probably damaging Het
Rp1l1 A T 14: 64,031,356 M1464L probably benign Het
Slc41a3 A G 6: 90,626,417 Y140C probably damaging Het
Ssb A T 2: 69,866,237 E38D possibly damaging Het
Syt14 A T 1: 193,026,984 I16N probably damaging Het
Tet3 T C 6: 83,375,896 T973A probably damaging Het
Tial1 T C 7: 128,443,968 probably benign Het
Tnfrsf1a A G 6: 125,360,712 T89A possibly damaging Het
Trpv5 T C 6: 41,675,945 Y98C possibly damaging Het
Ylpm1 T A 12: 85,015,493 S265T probably damaging Het
Ylpm1 A G 12: 85,042,239 D1006G probably damaging Het
Other mutations in Gpr139
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Gpr139 APN 7 119184287 missense probably benign 0.10
IGL02103:Gpr139 APN 7 119145132 missense possibly damaging 0.88
IGL02714:Gpr139 APN 7 119145119 missense possibly damaging 0.90
IGL02893:Gpr139 APN 7 119145143 missense probably damaging 1.00
R0082:Gpr139 UTSW 7 119145045 missense probably benign 0.11
R0542:Gpr139 UTSW 7 119145083 missense probably benign
R1912:Gpr139 UTSW 7 119144879 missense possibly damaging 0.62
R2148:Gpr139 UTSW 7 119144969 missense probably benign 0.08
R4568:Gpr139 UTSW 7 119144805 missense probably damaging 0.97
R4633:Gpr139 UTSW 7 119144405 missense probably damaging 0.99
R5186:Gpr139 UTSW 7 119144840 missense probably benign 0.00
R5252:Gpr139 UTSW 7 119145204 missense probably benign 0.13
R6518:Gpr139 UTSW 7 119144511 missense probably damaging 1.00
R6861:Gpr139 UTSW 7 119144652 missense probably benign 0.04
R7194:Gpr139 UTSW 7 119144673 missense possibly damaging 0.66
R7213:Gpr139 UTSW 7 119145099 missense probably benign
R7311:Gpr139 UTSW 7 119144866 missense probably benign 0.06
R7390:Gpr139 UTSW 7 119144612 missense probably benign 0.00
R7705:Gpr139 UTSW 7 119144643 missense probably benign 0.06
R8101:Gpr139 UTSW 7 119184287 missense probably benign 0.10
RF008:Gpr139 UTSW 7 119144867 missense probably benign 0.01
Z1177:Gpr139 UTSW 7 119144513 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AACAAGATGGCAGTGGTCTTC -3'
(R):5'- TTTGACCATGCAGATGCCTC -3'

Sequencing Primer
(F):5'- CCTAAGCTTGTACACAATGATGGAG -3'
(R):5'- GATGCCTCTGATCCCTGACAAG -3'
Posted On2016-06-21