Mutagenetix > Incidental Mutations

Incidental Mutation 'R5039:Gpr139'

List |< first << previous [record 23 of 53] next >> last >|

395703

Institutional Source

Beutler Lab

Gene Symbol

Gpr139

Ensembl Gene

ENSMUSG00000066197

Gene Name

G protein-coupled receptor 139

Synonyms

LOC209776, GPRg1

MMRRC Submission

042629-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5039 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119140747-119184603 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119144942 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 140 (V140A)

Ref Sequence

ENSEMBL: ENSMUSP00000081700 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084650]

Predicted Effect

probably benign
Transcript: ENSMUST00000084650
AA Change: V140A

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000081700
Gene: ENSMUSG00000066197
AA Change: V140A

Domain	Start	End	E-Value	Type
Pfam:7tm_1	35	277	2.9e-18	PFAM

Meta Mutation Damage Score

0.1862

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhodopsin family of G-protein-coupled receptors. The encoded protein is almost exclusively expressed in the central nervous system. L-tryptophan and L-phenylalanine may act as the physiologic ligands of the encoded protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	C	17: 33,067,760	C23G	probably damaging	Het
Abcg4	G	A	9: 44,281,566	A161V	probably damaging	Het
Anapc2	T	C	2: 25,274,796	I64T	possibly damaging	Het
Arfgef1	T	C	1: 10,199,736	D396G	probably benign	Het
Axl	C	T	7: 25,785,915	V163M	probably damaging	Het
Blm	G	A	7: 80,505,873	P353S	possibly damaging	Het
Btaf1	T	C	19: 36,990,762	Y1116H	probably benign	Het
Ccdc18	T	A	5: 108,158,648		probably null	Het
Ccdc87	T	C	19: 4,840,401		probably null	Het
Cdhr1	T	C	14: 37,079,643	N781S	probably benign	Het
Ctr9	C	A	7: 111,042,857	H297Q	probably benign	Het
Cyp2c55	A	G	19: 39,038,143	D398G	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dnmt3l	T	C	10: 78,052,900		probably null	Het
Dock4	C	A	12: 40,817,746	N1440K	probably damaging	Het
Etnk1	T	A	6: 143,195,317		probably null	Het
Fam120a	A	T	13: 48,910,250		probably null	Het
Fanca	T	C	8: 123,284,046	D908G	probably benign	Het
Gm17535	T	A	9: 3,035,786	L218H	probably benign	Het
Gm3633	A	C	14: 42,639,204	N42K	possibly damaging	Het
Gm4781	C	A	10: 100,396,989		noncoding transcript	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Ighv1-62-3	G	T	12: 115,461,394	T13K	probably benign	Het
Itgb2l	T	C	16: 96,425,005	T629A	possibly damaging	Het
Kcnb2	T	C	1: 15,709,500	S199P	probably damaging	Het
Kdm1b	G	A	13: 47,077,486	G663D	probably damaging	Het
Lama1	A	G	17: 67,745,893	D407G	possibly damaging	Het
Macf1	T	C	4: 123,511,220	K391R	probably damaging	Het
Magi3	A	T	3: 104,105,791	S127T	probably damaging	Het
Map2	A	T	1: 66,438,796	D1759V	probably damaging	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Myrfl	T	C	10: 116,822,711	D447G	probably damaging	Het
Ndufb7	A	G	8: 83,571,465		probably benign	Het
Nt5e	T	A	9: 88,363,581	N301K	probably benign	Het
Olfr944	T	A	9: 39,218,114	Y252*	probably null	Het
Olfr960	A	T	9: 39,623,560	T146S	possibly damaging	Het
Pcdh10	A	G	3: 45,381,861	N870S	probably damaging	Het
Pcdh18	A	G	3: 49,754,856	V670A	probably benign	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Ric3	G	C	7: 109,038,723	S274R	probably benign	Het
Rimbp3	A	G	16: 17,213,331	T1540A	probably damaging	Het
Rnf165	A	G	18: 77,462,912	S107P	probably damaging	Het
Rp1l1	A	T	14: 64,031,356	M1464L	probably benign	Het
Slc41a3	A	G	6: 90,626,417	Y140C	probably damaging	Het
Ssb	A	T	2: 69,866,237	E38D	possibly damaging	Het
Syt14	A	T	1: 193,026,984	I16N	probably damaging	Het
Tet3	T	C	6: 83,375,896	T973A	probably damaging	Het
Tial1	T	C	7: 128,443,968		probably benign	Het
Tnfrsf1a	A	G	6: 125,360,712	T89A	possibly damaging	Het
Trpv5	T	C	6: 41,675,945	Y98C	possibly damaging	Het
Ylpm1	T	A	12: 85,015,493	S265T	probably damaging	Het
Ylpm1	A	G	12: 85,042,239	D1006G	probably damaging	Het

Other mutations in Gpr139

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00924:Gpr139	APN	7	119184287	missense	probably benign	0.10
IGL02103:Gpr139	APN	7	119145132	missense	possibly damaging	0.88
IGL02714:Gpr139	APN	7	119145119	missense	possibly damaging	0.90
IGL02893:Gpr139	APN	7	119145143	missense	probably damaging	1.00
R0082:Gpr139	UTSW	7	119145045	missense	probably benign	0.11
R0542:Gpr139	UTSW	7	119145083	missense	probably benign
R1912:Gpr139	UTSW	7	119144879	missense	possibly damaging	0.62
R2148:Gpr139	UTSW	7	119144969	missense	probably benign	0.08
R4568:Gpr139	UTSW	7	119144805	missense	probably damaging	0.97
R4633:Gpr139	UTSW	7	119144405	missense	probably damaging	0.99
R5186:Gpr139	UTSW	7	119144840	missense	probably benign	0.00
R5252:Gpr139	UTSW	7	119145204	missense	probably benign	0.13
R6518:Gpr139	UTSW	7	119144511	missense	probably damaging	1.00
R6861:Gpr139	UTSW	7	119144652	missense	probably benign	0.04
R7194:Gpr139	UTSW	7	119144673	missense	possibly damaging	0.66
R7213:Gpr139	UTSW	7	119145099	missense	probably benign
R7311:Gpr139	UTSW	7	119144866	missense	probably benign	0.06
R7390:Gpr139	UTSW	7	119144612	missense	probably benign	0.00
R7705:Gpr139	UTSW	7	119144643	missense	probably benign	0.06
R8101:Gpr139	UTSW	7	119184287	missense	probably benign	0.10
RF008:Gpr139	UTSW	7	119144867	missense	probably benign	0.01
Z1177:Gpr139	UTSW	7	119144513	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AACAAGATGGCAGTGGTCTTC -3'
(R):5'- TTTGACCATGCAGATGCCTC -3'

Sequencing Primer
(F):5'- CCTAAGCTTGTACACAATGATGGAG -3'
(R):5'- GATGCCTCTGATCCCTGACAAG -3'

Posted On

2016-06-21