Incidental Mutation 'R5039:Tial1'
ID395704
Institutional Source Beutler Lab
Gene Symbol Tial1
Ensembl Gene ENSMUSG00000030846
Gene NameTia1 cytotoxic granule-associated RNA binding protein-like 1
SynonymsmTIAR, 5330433G13Rik, TIAR
MMRRC Submission 042629-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R5039 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location128439777-128461717 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 128443968 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033135] [ENSMUST00000106226] [ENSMUST00000106228] [ENSMUST00000123666] [ENSMUST00000133444] [ENSMUST00000141126] [ENSMUST00000165023] [ENSMUST00000205278] [ENSMUST00000205835]
Predicted Effect probably benign
Transcript: ENSMUST00000033135
SMART Domains Protein: ENSMUSP00000033135
Gene: ENSMUSG00000030846

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
RRM 98 171 2.76e-26 SMART
RRM 206 273 1.19e-16 SMART
low complexity region 343 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106226
SMART Domains Protein: ENSMUSP00000101833
Gene: ENSMUSG00000030846

DomainStartEndE-ValueType
RRM 10 98 7.41e-18 SMART
RRM 115 188 2.76e-26 SMART
RRM 223 290 1.19e-16 SMART
low complexity region 360 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106228
SMART Domains Protein: ENSMUSP00000101835
Gene: ENSMUSG00000030846

DomainStartEndE-ValueType
Pfam:RRM_1 11 50 1.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123666
SMART Domains Protein: ENSMUSP00000116921
Gene: ENSMUSG00000030846

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
Pfam:RRM_1 99 132 1.3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133089
Predicted Effect probably benign
Transcript: ENSMUST00000133444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141079
Predicted Effect probably benign
Transcript: ENSMUST00000141126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152328
Predicted Effect probably benign
Transcript: ENSMUST00000165023
SMART Domains Protein: ENSMUSP00000126458
Gene: ENSMUSG00000030846

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
RRM 98 171 2.76e-26 SMART
RRM 206 273 1.19e-16 SMART
low complexity region 343 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205774
Predicted Effect probably benign
Transcript: ENSMUST00000205835
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of RNA-binding proteins, has three RNA recognition motifs (RRMs), and binds adenine and uridine-rich elements in mRNA and pre-mRNAs of a wide range of genes. It regulates various activities including translational control, splicing and apoptosis. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. The different isoforms have been show to function differently with respect to post-transcriptional silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit partial embryonic lethality and reduced postnatal survival, reduced embryonic and postnatal body weight, and male and female sterility. Infertility is owed to a substantial decrease in the survival of primordial germ cells atthe genital ridge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,760 C23G probably damaging Het
Abcg4 G A 9: 44,281,566 A161V probably damaging Het
Anapc2 T C 2: 25,274,796 I64T possibly damaging Het
Arfgef1 T C 1: 10,199,736 D396G probably benign Het
Axl C T 7: 25,785,915 V163M probably damaging Het
Blm G A 7: 80,505,873 P353S possibly damaging Het
Btaf1 T C 19: 36,990,762 Y1116H probably benign Het
Ccdc18 T A 5: 108,158,648 probably null Het
Ccdc87 T C 19: 4,840,401 probably null Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ctr9 C A 7: 111,042,857 H297Q probably benign Het
Cyp2c55 A G 19: 39,038,143 D398G probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnmt3l T C 10: 78,052,900 probably null Het
Dock4 C A 12: 40,817,746 N1440K probably damaging Het
Etnk1 T A 6: 143,195,317 probably null Het
Fam120a A T 13: 48,910,250 probably null Het
Fanca T C 8: 123,284,046 D908G probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3633 A C 14: 42,639,204 N42K possibly damaging Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gpr139 A G 7: 119,144,942 V140A probably benign Het
Ighv1-62-3 G T 12: 115,461,394 T13K probably benign Het
Itgb2l T C 16: 96,425,005 T629A possibly damaging Het
Kcnb2 T C 1: 15,709,500 S199P probably damaging Het
Kdm1b G A 13: 47,077,486 G663D probably damaging Het
Lama1 A G 17: 67,745,893 D407G possibly damaging Het
Macf1 T C 4: 123,511,220 K391R probably damaging Het
Magi3 A T 3: 104,105,791 S127T probably damaging Het
Map2 A T 1: 66,438,796 D1759V probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myrfl T C 10: 116,822,711 D447G probably damaging Het
Ndufb7 A G 8: 83,571,465 probably benign Het
Nt5e T A 9: 88,363,581 N301K probably benign Het
Olfr944 T A 9: 39,218,114 Y252* probably null Het
Olfr960 A T 9: 39,623,560 T146S possibly damaging Het
Pcdh10 A G 3: 45,381,861 N870S probably damaging Het
Pcdh18 A G 3: 49,754,856 V670A probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ric3 G C 7: 109,038,723 S274R probably benign Het
Rimbp3 A G 16: 17,213,331 T1540A probably damaging Het
Rnf165 A G 18: 77,462,912 S107P probably damaging Het
Rp1l1 A T 14: 64,031,356 M1464L probably benign Het
Slc41a3 A G 6: 90,626,417 Y140C probably damaging Het
Ssb A T 2: 69,866,237 E38D possibly damaging Het
Syt14 A T 1: 193,026,984 I16N probably damaging Het
Tet3 T C 6: 83,375,896 T973A probably damaging Het
Tnfrsf1a A G 6: 125,360,712 T89A possibly damaging Het
Trpv5 T C 6: 41,675,945 Y98C possibly damaging Het
Ylpm1 T A 12: 85,015,493 S265T probably damaging Het
Ylpm1 A G 12: 85,042,239 D1006G probably damaging Het
Other mutations in Tial1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Tial1 APN 7 128448345 missense probably damaging 1.00
IGL02623:Tial1 APN 7 128443883 missense probably benign 0.12
IGL02936:Tial1 APN 7 128442663 splice site probably benign
R0798:Tial1 UTSW 7 128443878 missense probably benign 0.04
R1583:Tial1 UTSW 7 128443910 missense probably damaging 1.00
R1913:Tial1 UTSW 7 128444659 missense probably damaging 1.00
R4863:Tial1 UTSW 7 128455028 missense probably damaging 1.00
R5026:Tial1 UTSW 7 128448396 missense probably damaging 0.97
R5629:Tial1 UTSW 7 128444697 missense probably damaging 0.97
R6697:Tial1 UTSW 7 128444869 missense possibly damaging 0.94
R8072:Tial1 UTSW 7 128442470 missense unknown
R8178:Tial1 UTSW 7 128444890 missense probably benign 0.01
Z1177:Tial1 UTSW 7 128442639 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AAGCGCATCTGTTTCTACAATGG -3'
(R):5'- GCATATAGCTGCTTTCAGTTGATTG -3'

Sequencing Primer
(F):5'- CGCATCTGTTTCTACAATGGAAAAAC -3'
(R):5'- GCTTTCAGTTGATTGTGTAAAATGC -3'
Posted On2016-06-21