Mutagenetix > Incidental Mutations

Incidental Mutation 'R5039:Fanca'

List |< first << previous [record 18 of 53] next >> last >|

395706

Institutional Source

Beutler Lab

Gene Symbol

Fanca

Ensembl Gene

ENSMUSG00000032815

Gene Name

Fanconi anemia, complementation group A

Synonyms

MMRRC Submission

042629-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.729) question?

Stock #

R5039 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123268300-123318576 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123284046 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 908 (D908G)

Ref Sequence

ENSEMBL: ENSMUSP00000045217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035495] [ENSMUST00000127664] [ENSMUST00000127904]

Predicted Effect

probably benign
Transcript: ENSMUST00000035495
AA Change: D908G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815
AA Change: D908G

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	78	100	N/A	INTRINSIC
Pfam:Fanconi_A_N	167	520	3.7e-146	PFAM
low complexity region	645	660	N/A	INTRINSIC
low complexity region	778	790	N/A	INTRINSIC
low complexity region	1069	1079	N/A	INTRINSIC
low complexity region	1200	1225	N/A	INTRINSIC
Pfam:Fanconi_A	1246	1308	8.4e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127904

SMART Domains

Protein: ENSMUSP00000116614
Gene: ENSMUSG00000032815

Domain	Start	End	E-Value	Type
low complexity region	547	562	N/A	INTRINSIC
low complexity region	680	692	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146687

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155279

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155488

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	C	17: 33,067,760	C23G	probably damaging	Het
Abcg4	G	A	9: 44,281,566	A161V	probably damaging	Het
Anapc2	T	C	2: 25,274,796	I64T	possibly damaging	Het
Arfgef1	T	C	1: 10,199,736	D396G	probably benign	Het
Axl	C	T	7: 25,785,915	V163M	probably damaging	Het
Blm	G	A	7: 80,505,873	P353S	possibly damaging	Het
Btaf1	T	C	19: 36,990,762	Y1116H	probably benign	Het
Ccdc18	T	A	5: 108,158,648		probably null	Het
Ccdc87	T	C	19: 4,840,401		probably null	Het
Cdhr1	T	C	14: 37,079,643	N781S	probably benign	Het
Ctr9	C	A	7: 111,042,857	H297Q	probably benign	Het
Cyp2c55	A	G	19: 39,038,143	D398G	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dnmt3l	T	C	10: 78,052,900		probably null	Het
Dock4	C	A	12: 40,817,746	N1440K	probably damaging	Het
Etnk1	T	A	6: 143,195,317		probably null	Het
Fam120a	A	T	13: 48,910,250		probably null	Het
Gm17535	T	A	9: 3,035,786	L218H	probably benign	Het
Gm3633	A	C	14: 42,639,204	N42K	possibly damaging	Het
Gm4781	C	A	10: 100,396,989		noncoding transcript	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Gpr139	A	G	7: 119,144,942	V140A	probably benign	Het
Ighv1-62-3	G	T	12: 115,461,394	T13K	probably benign	Het
Itgb2l	T	C	16: 96,425,005	T629A	possibly damaging	Het
Kcnb2	T	C	1: 15,709,500	S199P	probably damaging	Het
Kdm1b	G	A	13: 47,077,486	G663D	probably damaging	Het
Lama1	A	G	17: 67,745,893	D407G	possibly damaging	Het
Macf1	T	C	4: 123,511,220	K391R	probably damaging	Het
Magi3	A	T	3: 104,105,791	S127T	probably damaging	Het
Map2	A	T	1: 66,438,796	D1759V	probably damaging	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Myrfl	T	C	10: 116,822,711	D447G	probably damaging	Het
Ndufb7	A	G	8: 83,571,465		probably benign	Het
Nt5e	T	A	9: 88,363,581	N301K	probably benign	Het
Olfr944	T	A	9: 39,218,114	Y252*	probably null	Het
Olfr960	A	T	9: 39,623,560	T146S	possibly damaging	Het
Pcdh10	A	G	3: 45,381,861	N870S	probably damaging	Het
Pcdh18	A	G	3: 49,754,856	V670A	probably benign	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Ric3	G	C	7: 109,038,723	S274R	probably benign	Het
Rimbp3	A	G	16: 17,213,331	T1540A	probably damaging	Het
Rnf165	A	G	18: 77,462,912	S107P	probably damaging	Het
Rp1l1	A	T	14: 64,031,356	M1464L	probably benign	Het
Slc41a3	A	G	6: 90,626,417	Y140C	probably damaging	Het
Ssb	A	T	2: 69,866,237	E38D	possibly damaging	Het
Syt14	A	T	1: 193,026,984	I16N	probably damaging	Het
Tet3	T	C	6: 83,375,896	T973A	probably damaging	Het
Tial1	T	C	7: 128,443,968		probably benign	Het
Tnfrsf1a	A	G	6: 125,360,712	T89A	possibly damaging	Het
Trpv5	T	C	6: 41,675,945	Y98C	possibly damaging	Het
Ylpm1	T	A	12: 85,015,493	S265T	probably damaging	Het
Ylpm1	A	G	12: 85,042,239	D1006G	probably damaging	Het

Other mutations in Fanca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02348:Fanca	APN	8	123305263	missense	probably damaging	1.00
IGL02805:Fanca	APN	8	123289494	missense	probably damaging	0.99
IGL03280:Fanca	APN	8	123316459	unclassified	probably benign
PIT4402001:Fanca	UTSW	8	123313064	missense	possibly damaging	0.83
R0114:Fanca	UTSW	8	123288491	splice site	probably null
R0115:Fanca	UTSW	8	123268539	missense	probably benign	0.00
R0271:Fanca	UTSW	8	123272441	unclassified	probably benign
R0330:Fanca	UTSW	8	123274172	nonsense	probably null
R0345:Fanca	UTSW	8	123304813	missense	probably damaging	1.00
R0570:Fanca	UTSW	8	123306430	missense	probably benign	0.01
R0601:Fanca	UTSW	8	123308513	missense	probably damaging	0.99
R0617:Fanca	UTSW	8	123288070	missense	probably damaging	0.99
R0639:Fanca	UTSW	8	123289359	critical splice donor site	probably null
R0943:Fanca	UTSW	8	123274186	missense	probably damaging	1.00
R1140:Fanca	UTSW	8	123313129	splice site	probably null
R1364:Fanca	UTSW	8	123304281	splice site	probably benign
R1366:Fanca	UTSW	8	123304281	splice site	probably benign
R1367:Fanca	UTSW	8	123304281	splice site	probably benign
R1368:Fanca	UTSW	8	123304281	splice site	probably benign
R1969:Fanca	UTSW	8	123288064	missense	probably benign	0.41
R1992:Fanca	UTSW	8	123297812	missense	possibly damaging	0.94
R2060:Fanca	UTSW	8	123274481	missense	probably damaging	1.00
R2174:Fanca	UTSW	8	123271270	missense	probably benign	0.00
R2261:Fanca	UTSW	8	123289359	critical splice donor site	probably null
R3957:Fanca	UTSW	8	123316363	missense	probably benign	0.00
R4062:Fanca	UTSW	8	123275172	missense	probably benign	0.00
R4153:Fanca	UTSW	8	123304878	missense	possibly damaging	0.89
R4270:Fanca	UTSW	8	123268794	missense	probably damaging	1.00
R4424:Fanca	UTSW	8	123288793	missense	probably benign	0.11
R4581:Fanca	UTSW	8	123274338	splice site	probably null
R4639:Fanca	UTSW	8	123318150	missense	probably damaging	0.98
R4664:Fanca	UTSW	8	123268972	missense	probably damaging	0.99
R4665:Fanca	UTSW	8	123268972	missense	probably damaging	0.99
R4666:Fanca	UTSW	8	123268972	missense	probably damaging	0.99
R4686:Fanca	UTSW	8	123268934	splice site	probably benign
R4775:Fanca	UTSW	8	123296306	missense	probably damaging	0.99
R4782:Fanca	UTSW	8	123288202	missense	probably damaging	1.00
R4799:Fanca	UTSW	8	123288202	missense	probably damaging	1.00
R4926:Fanca	UTSW	8	123303985	missense	probably benign	0.05
R4973:Fanca	UTSW	8	123308522	missense	probably damaging	0.96
R5195:Fanca	UTSW	8	123303945	intron	probably benign
R5590:Fanca	UTSW	8	123303963	intron	probably benign
R5848:Fanca	UTSW	8	123295053	intron	probably benign
R5965:Fanca	UTSW	8	123316410	missense	possibly damaging	0.46
R6224:Fanca	UTSW	8	123305281	missense	possibly damaging	0.87
R6385:Fanca	UTSW	8	123305867	splice site	probably null
R6762:Fanca	UTSW	8	123271303	missense	probably benign	0.26
R6795:Fanca	UTSW	8	123318493	missense	probably benign	0.02
R6810:Fanca	UTSW	8	123286477	missense	probably damaging	0.99
R7153:Fanca	UTSW	8	123316425	missense	probably damaging	1.00
R7170:Fanca	UTSW	8	123271206	missense	probably damaging	1.00
R7204:Fanca	UTSW	8	123286477	missense	probably damaging	0.98
R7366:Fanca	UTSW	8	123281213	missense	probably benign	0.08
R7599:Fanca	UTSW	8	123271260	missense	probably benign
R7639:Fanca	UTSW	8	123291395	critical splice donor site	probably null
R7650:Fanca	UTSW	8	123268564	splice site	probably null
R8066:Fanca	UTSW	8	123303940	missense	unknown
R8247:Fanca	UTSW	8	123283955	unclassified	probably benign
R8312:Fanca	UTSW	8	123269810	intron	probably benign
R8327:Fanca	UTSW	8	123313245	nonsense	probably null
V7732:Fanca	UTSW	8	123304281	splice site	probably benign
X0025:Fanca	UTSW	8	123276548	intron	probably benign
X0062:Fanca	UTSW	8	123304852	missense	possibly damaging	0.95
Z1177:Fanca	UTSW	8	123312629	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTCCACTTGGACAAAGGCCAAG -3'
(R):5'- TGGGTTCACAAGAAGGTGGC -3'

Sequencing Primer
(F):5'- CACTTGGACAAAGGCCAAGGTAAAC -3'
(R):5'- CAGGTAAGATGCCCTGGTG -3'

Posted On

2016-06-21