Incidental Mutation 'R5039:Olfr960'
ID395708
Institutional Source Beutler Lab
Gene Symbol Olfr960
Ensembl Gene ENSMUSG00000059867
Gene Nameolfactory receptor 960
SynonymsMOR224-12, GA_x6K02T2PVTD-33320043-33320987
MMRRC Submission 042629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5039 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39621373-39624205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39623560 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 146 (T146S)
Ref Sequence ENSEMBL: ENSMUSP00000076315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077060] [ENSMUST00000216584]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077060
AA Change: T146S

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076315
Gene: ENSMUSG00000059867
AA Change: T146S

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.3e-48 PFAM
Pfam:7tm_1 41 288 1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215616
Predicted Effect probably benign
Transcript: ENSMUST00000216584
AA Change: T144S

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,760 C23G probably damaging Het
Abcg4 G A 9: 44,281,566 A161V probably damaging Het
Anapc2 T C 2: 25,274,796 I64T possibly damaging Het
Arfgef1 T C 1: 10,199,736 D396G probably benign Het
Axl C T 7: 25,785,915 V163M probably damaging Het
Blm G A 7: 80,505,873 P353S possibly damaging Het
Btaf1 T C 19: 36,990,762 Y1116H probably benign Het
Ccdc18 T A 5: 108,158,648 probably null Het
Ccdc87 T C 19: 4,840,401 probably null Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ctr9 C A 7: 111,042,857 H297Q probably benign Het
Cyp2c55 A G 19: 39,038,143 D398G probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnmt3l T C 10: 78,052,900 probably null Het
Dock4 C A 12: 40,817,746 N1440K probably damaging Het
Etnk1 T A 6: 143,195,317 probably null Het
Fam120a A T 13: 48,910,250 probably null Het
Fanca T C 8: 123,284,046 D908G probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3633 A C 14: 42,639,204 N42K possibly damaging Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gpr139 A G 7: 119,144,942 V140A probably benign Het
Ighv1-62-3 G T 12: 115,461,394 T13K probably benign Het
Itgb2l T C 16: 96,425,005 T629A possibly damaging Het
Kcnb2 T C 1: 15,709,500 S199P probably damaging Het
Kdm1b G A 13: 47,077,486 G663D probably damaging Het
Lama1 A G 17: 67,745,893 D407G possibly damaging Het
Macf1 T C 4: 123,511,220 K391R probably damaging Het
Magi3 A T 3: 104,105,791 S127T probably damaging Het
Map2 A T 1: 66,438,796 D1759V probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myrfl T C 10: 116,822,711 D447G probably damaging Het
Ndufb7 A G 8: 83,571,465 probably benign Het
Nt5e T A 9: 88,363,581 N301K probably benign Het
Olfr944 T A 9: 39,218,114 Y252* probably null Het
Pcdh10 A G 3: 45,381,861 N870S probably damaging Het
Pcdh18 A G 3: 49,754,856 V670A probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ric3 G C 7: 109,038,723 S274R probably benign Het
Rimbp3 A G 16: 17,213,331 T1540A probably damaging Het
Rnf165 A G 18: 77,462,912 S107P probably damaging Het
Rp1l1 A T 14: 64,031,356 M1464L probably benign Het
Slc41a3 A G 6: 90,626,417 Y140C probably damaging Het
Ssb A T 2: 69,866,237 E38D possibly damaging Het
Syt14 A T 1: 193,026,984 I16N probably damaging Het
Tet3 T C 6: 83,375,896 T973A probably damaging Het
Tial1 T C 7: 128,443,968 probably benign Het
Tnfrsf1a A G 6: 125,360,712 T89A possibly damaging Het
Trpv5 T C 6: 41,675,945 Y98C possibly damaging Het
Ylpm1 T A 12: 85,015,493 S265T probably damaging Het
Ylpm1 A G 12: 85,042,239 D1006G probably damaging Het
Other mutations in Olfr960
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Olfr960 APN 9 39623365 missense probably benign 0.37
IGL03031:Olfr960 APN 9 39623398 missense probably damaging 1.00
IGL03199:Olfr960 APN 9 39623944 missense probably benign 0.02
R2510:Olfr960 UTSW 9 39623431 missense probably damaging 1.00
R4829:Olfr960 UTSW 9 39623438 missense probably damaging 1.00
R5394:Olfr960 UTSW 9 39623134 missense probably benign 0.20
R5934:Olfr960 UTSW 9 39623183 missense probably damaging 1.00
R6030:Olfr960 UTSW 9 39623341 missense probably damaging 1.00
R6030:Olfr960 UTSW 9 39623341 missense probably damaging 1.00
R7491:Olfr960 UTSW 9 39623972 missense possibly damaging 0.65
R7509:Olfr960 UTSW 9 39623327 missense probably damaging 0.96
R8063:Olfr960 UTSW 9 39623527 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACATGGGCTTCTGTTCCAC -3'
(R):5'- ATTTGTGAAACCTACCCTCTGTG -3'

Sequencing Primer
(F):5'- CCAAGATGTTGTCATATCTCTCAGG -3'
(R):5'- CTGTGCTAGAGAGGAATCTTCAC -3'
Posted On2016-06-21