Mutagenetix > Incidental Mutations

Incidental Mutation 'R5039:Dnmt3l'

List |< first << previous [record 14 of 53] next >> last >|

395712

Institutional Source

Beutler Lab

Gene Symbol

Dnmt3l

Ensembl Gene

ENSMUSG00000000730

Gene Name

DNA (cytosine-5-)-methyltransferase 3-like

Synonyms

D6Ertd14e, ecat7

MMRRC Submission

042629-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5039 (G1)

Quality Score

202

Status

Validated

Chromosome

Chromosomal Location

78041947-78063622 bp(+) (GRCm38)

Type of Mutation

splice site (17 bp from exon)

DNA Base Change (assembly)

T to C at 78052900 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000116970 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000746] [ENSMUST00000123940] [ENSMUST00000131825] [ENSMUST00000138785] [ENSMUST00000139539] [ENSMUST00000151242]

Predicted Effect

probably null
Transcript: ENSMUST00000000746

SMART Domains

Protein: ENSMUSP00000000746
Gene: ENSMUSG00000000730

Domain	Start	End	E-Value	Type
low complexity region	22	32	N/A	INTRINSIC
PDB:2PVC\|C	38	415	1e-163	PDB
SCOP:d1fp0a1	123	191	5e-3	SMART
Blast:RING	130	179	1e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000123940

SMART Domains

Protein: ENSMUSP00000123015
Gene: ENSMUSG00000000730

Domain	Start	End	E-Value	Type
PDB:2QRV\|G	1	120	1e-38	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000131825

SMART Domains

Protein: ENSMUSP00000119571
Gene: ENSMUSG00000000730

Domain	Start	End	E-Value	Type
PDB:2QRV\|G	1	120	1e-38	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000138785

SMART Domains

Protein: ENSMUSP00000121562
Gene: ENSMUSG00000000730

Domain	Start	End	E-Value	Type
low complexity region	22	32	N/A	INTRINSIC
PDB:2PVC\|C	38	415	1e-163	PDB
SCOP:d1fp0a1	123	191	5e-3	SMART
Blast:RING	130	179	1e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000139539

SMART Domains

Protein: ENSMUSP00000117827
Gene: ENSMUSG00000000730

Domain	Start	End	E-Value	Type
PDB:2QRV\|G	1	120	1e-38	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144446

Predicted Effect

probably null
Transcript: ENSMUST00000151242

SMART Domains

Protein: ENSMUSP00000116970
Gene: ENSMUSG00000000730

Domain	Start	End	E-Value	Type
low complexity region	22	32	N/A	INTRINSIC
PDB:2PVC\|C	38	415	1e-163	PDB
SCOP:d1fp0a1	123	191	5e-3	SMART
Blast:RING	130	179	1e-18	BLAST

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a nuclear protein that is a catalytically inactive regulatory factor of DNA methyltransferases. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutants in this imprinted gene lack appropriate methylation of the maternal allele and this, in turn, causes azoospermia in homozygous males; and heterozygous progeny of homozygous females die by midgestation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	C	17: 33,067,760	C23G	probably damaging	Het
Abcg4	G	A	9: 44,281,566	A161V	probably damaging	Het
Anapc2	T	C	2: 25,274,796	I64T	possibly damaging	Het
Arfgef1	T	C	1: 10,199,736	D396G	probably benign	Het
Axl	C	T	7: 25,785,915	V163M	probably damaging	Het
Blm	G	A	7: 80,505,873	P353S	possibly damaging	Het
Btaf1	T	C	19: 36,990,762	Y1116H	probably benign	Het
Ccdc18	T	A	5: 108,158,648		probably null	Het
Ccdc87	T	C	19: 4,840,401		probably null	Het
Cdhr1	T	C	14: 37,079,643	N781S	probably benign	Het
Ctr9	C	A	7: 111,042,857	H297Q	probably benign	Het
Cyp2c55	A	G	19: 39,038,143	D398G	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dock4	C	A	12: 40,817,746	N1440K	probably damaging	Het
Etnk1	T	A	6: 143,195,317		probably null	Het
Fam120a	A	T	13: 48,910,250		probably null	Het
Fanca	T	C	8: 123,284,046	D908G	probably benign	Het
Gm17535	T	A	9: 3,035,786	L218H	probably benign	Het
Gm3633	A	C	14: 42,639,204	N42K	possibly damaging	Het
Gm4781	C	A	10: 100,396,989		noncoding transcript	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Gpr139	A	G	7: 119,144,942	V140A	probably benign	Het
Ighv1-62-3	G	T	12: 115,461,394	T13K	probably benign	Het
Itgb2l	T	C	16: 96,425,005	T629A	possibly damaging	Het
Kcnb2	T	C	1: 15,709,500	S199P	probably damaging	Het
Kdm1b	G	A	13: 47,077,486	G663D	probably damaging	Het
Lama1	A	G	17: 67,745,893	D407G	possibly damaging	Het
Macf1	T	C	4: 123,511,220	K391R	probably damaging	Het
Magi3	A	T	3: 104,105,791	S127T	probably damaging	Het
Map2	A	T	1: 66,438,796	D1759V	probably damaging	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Myrfl	T	C	10: 116,822,711	D447G	probably damaging	Het
Ndufb7	A	G	8: 83,571,465		probably benign	Het
Nt5e	T	A	9: 88,363,581	N301K	probably benign	Het
Olfr944	T	A	9: 39,218,114	Y252*	probably null	Het
Olfr960	A	T	9: 39,623,560	T146S	possibly damaging	Het
Pcdh10	A	G	3: 45,381,861	N870S	probably damaging	Het
Pcdh18	A	G	3: 49,754,856	V670A	probably benign	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Ric3	G	C	7: 109,038,723	S274R	probably benign	Het
Rimbp3	A	G	16: 17,213,331	T1540A	probably damaging	Het
Rnf165	A	G	18: 77,462,912	S107P	probably damaging	Het
Rp1l1	A	T	14: 64,031,356	M1464L	probably benign	Het
Slc41a3	A	G	6: 90,626,417	Y140C	probably damaging	Het
Ssb	A	T	2: 69,866,237	E38D	possibly damaging	Het
Syt14	A	T	1: 193,026,984	I16N	probably damaging	Het
Tet3	T	C	6: 83,375,896	T973A	probably damaging	Het
Tial1	T	C	7: 128,443,968		probably benign	Het
Tnfrsf1a	A	G	6: 125,360,712	T89A	possibly damaging	Het
Trpv5	T	C	6: 41,675,945	Y98C	possibly damaging	Het
Ylpm1	T	A	12: 85,015,493	S265T	probably damaging	Het
Ylpm1	A	G	12: 85,042,239	D1006G	probably damaging	Het

Other mutations in Dnmt3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Dnmt3l	APN	10	78057355	missense	probably damaging	1.00
IGL00827:Dnmt3l	APN	10	78053996	missense	probably damaging	1.00
IGL01072:Dnmt3l	APN	10	78052771	missense	probably benign	0.09
IGL01118:Dnmt3l	APN	10	78057286	missense	probably damaging	0.97
IGL01553:Dnmt3l	APN	10	78063248	missense	probably benign	0.00
IGL02322:Dnmt3l	APN	10	78052738	missense	possibly damaging	0.90
IGL02323:Dnmt3l	APN	10	78063318	missense	probably damaging	1.00
IGL02618:Dnmt3l	APN	10	78054022	splice site	probably benign
IGL02701:Dnmt3l	APN	10	78055022	missense	probably benign	0.01
IGL02950:Dnmt3l	APN	10	78050951	missense	probably benign	0.01
R0318:Dnmt3l	UTSW	10	78055055	missense	probably damaging	1.00
R0384:Dnmt3l	UTSW	10	78052737	missense	possibly damaging	0.95
R0391:Dnmt3l	UTSW	10	78051916	splice site	probably benign
R1144:Dnmt3l	UTSW	10	78051905	missense	probably damaging	1.00
R2069:Dnmt3l	UTSW	10	78052732	missense	probably damaging	1.00
R2115:Dnmt3l	UTSW	10	78063296	missense	probably damaging	0.99
R2116:Dnmt3l	UTSW	10	78063296	missense	probably damaging	0.99
R2117:Dnmt3l	UTSW	10	78063296	missense	probably damaging	0.99
R4812:Dnmt3l	UTSW	10	78057294	missense	probably benign	0.06
R5001:Dnmt3l	UTSW	10	78059731	missense	probably null	1.00
R5389:Dnmt3l	UTSW	10	78056831	splice site	probably null
R5799:Dnmt3l	UTSW	10	78052026	missense	possibly damaging	0.71
R5811:Dnmt3l	UTSW	10	78052095	missense	possibly damaging	0.78
R5875:Dnmt3l	UTSW	10	78053938	missense	probably benign
R6314:Dnmt3l	UTSW	10	78059687	missense	probably benign	0.00
R6537:Dnmt3l	UTSW	10	78052064	missense	probably null	1.00
R8437:Dnmt3l	UTSW	10	78052768	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TCGAGTGTGTGGACATCCTG -3'
(R):5'- GCGTCCACAGCAATTTAAGTG -3'

Sequencing Primer
(F):5'- TGGACATCCTGGTGGGC -3'
(R):5'- CCATCCTTGGCTACATAGTGAATTTG -3'

Posted On

2016-06-21