Incidental Mutation 'R5039:Mllt6'
ID395715
Institutional Source Beutler Lab
Gene Symbol Mllt6
Ensembl Gene ENSMUSG00000038437
Gene Namemyeloid/lymphoid or mixed-lineage leukemia; translocated to, 6
SynonymsAf17
MMRRC Submission 042629-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5039 (G1)
Quality Score121
Status Validated
Chromosome11
Chromosomal Location97663414-97685463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97669500 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 210 (S210N)
Ref Sequence ENSEMBL: ENSMUSP00000045445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044730] [ENSMUST00000107586]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044730
AA Change: S210N

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045445
Gene: ENSMUSG00000038437
AA Change: S210N

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 358 380 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 520 536 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 649 666 N/A INTRINSIC
coiled coil region 703 744 N/A INTRINSIC
low complexity region 746 756 N/A INTRINSIC
low complexity region 773 782 N/A INTRINSIC
low complexity region 802 848 N/A INTRINSIC
low complexity region 860 901 N/A INTRINSIC
coiled coil region 915 942 N/A INTRINSIC
low complexity region 995 1018 N/A INTRINSIC
low complexity region 1026 1037 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107586
AA Change: S210N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103212
Gene: ENSMUSG00000038437
AA Change: S210N

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 336 356 N/A INTRINSIC
low complexity region 388 410 N/A INTRINSIC
low complexity region 428 442 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
low complexity region 532 546 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 609 631 N/A INTRINSIC
low complexity region 679 696 N/A INTRINSIC
coiled coil region 733 774 N/A INTRINSIC
low complexity region 776 786 N/A INTRINSIC
low complexity region 803 812 N/A INTRINSIC
low complexity region 832 878 N/A INTRINSIC
low complexity region 890 931 N/A INTRINSIC
coiled coil region 945 972 N/A INTRINSIC
low complexity region 1025 1048 N/A INTRINSIC
low complexity region 1056 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155835
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,760 C23G probably damaging Het
Abcg4 G A 9: 44,281,566 A161V probably damaging Het
Anapc2 T C 2: 25,274,796 I64T possibly damaging Het
Arfgef1 T C 1: 10,199,736 D396G probably benign Het
Axl C T 7: 25,785,915 V163M probably damaging Het
Blm G A 7: 80,505,873 P353S possibly damaging Het
Btaf1 T C 19: 36,990,762 Y1116H probably benign Het
Ccdc18 T A 5: 108,158,648 probably null Het
Ccdc87 T C 19: 4,840,401 probably null Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ctr9 C A 7: 111,042,857 H297Q probably benign Het
Cyp2c55 A G 19: 39,038,143 D398G probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnmt3l T C 10: 78,052,900 probably null Het
Dock4 C A 12: 40,817,746 N1440K probably damaging Het
Etnk1 T A 6: 143,195,317 probably null Het
Fam120a A T 13: 48,910,250 probably null Het
Fanca T C 8: 123,284,046 D908G probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3633 A C 14: 42,639,204 N42K possibly damaging Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gpr139 A G 7: 119,144,942 V140A probably benign Het
Ighv1-62-3 G T 12: 115,461,394 T13K probably benign Het
Itgb2l T C 16: 96,425,005 T629A possibly damaging Het
Kcnb2 T C 1: 15,709,500 S199P probably damaging Het
Kdm1b G A 13: 47,077,486 G663D probably damaging Het
Lama1 A G 17: 67,745,893 D407G possibly damaging Het
Macf1 T C 4: 123,511,220 K391R probably damaging Het
Magi3 A T 3: 104,105,791 S127T probably damaging Het
Map2 A T 1: 66,438,796 D1759V probably damaging Het
Myrfl T C 10: 116,822,711 D447G probably damaging Het
Ndufb7 A G 8: 83,571,465 probably benign Het
Nt5e T A 9: 88,363,581 N301K probably benign Het
Olfr944 T A 9: 39,218,114 Y252* probably null Het
Olfr960 A T 9: 39,623,560 T146S possibly damaging Het
Pcdh10 A G 3: 45,381,861 N870S probably damaging Het
Pcdh18 A G 3: 49,754,856 V670A probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ric3 G C 7: 109,038,723 S274R probably benign Het
Rimbp3 A G 16: 17,213,331 T1540A probably damaging Het
Rnf165 A G 18: 77,462,912 S107P probably damaging Het
Rp1l1 A T 14: 64,031,356 M1464L probably benign Het
Slc41a3 A G 6: 90,626,417 Y140C probably damaging Het
Ssb A T 2: 69,866,237 E38D possibly damaging Het
Syt14 A T 1: 193,026,984 I16N probably damaging Het
Tet3 T C 6: 83,375,896 T973A probably damaging Het
Tial1 T C 7: 128,443,968 probably benign Het
Tnfrsf1a A G 6: 125,360,712 T89A possibly damaging Het
Trpv5 T C 6: 41,675,945 Y98C possibly damaging Het
Ylpm1 T A 12: 85,015,493 S265T probably damaging Het
Ylpm1 A G 12: 85,042,239 D1006G probably damaging Het
Other mutations in Mllt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Mllt6 APN 11 97676928 missense probably damaging 1.00
IGL01808:Mllt6 APN 11 97672484 missense possibly damaging 0.88
IGL01967:Mllt6 APN 11 97674777 missense probably damaging 0.98
IGL02247:Mllt6 APN 11 97670332 missense probably benign 0.01
IGL03161:Mllt6 APN 11 97667151 missense probably benign 0.03
R0284:Mllt6 UTSW 11 97678605 missense probably benign 0.02
R0718:Mllt6 UTSW 11 97676359 splice site probably benign
R0783:Mllt6 UTSW 11 97665745 missense probably damaging 0.99
R0811:Mllt6 UTSW 11 97678561 missense probably damaging 0.97
R0812:Mllt6 UTSW 11 97678561 missense probably damaging 0.97
R0904:Mllt6 UTSW 11 97664998 missense probably damaging 1.00
R0960:Mllt6 UTSW 11 97664946 splice site probably benign
R1445:Mllt6 UTSW 11 97672451 splice site probably benign
R1523:Mllt6 UTSW 11 97665023 missense probably damaging 1.00
R1781:Mllt6 UTSW 11 97672569 missense probably benign
R1952:Mllt6 UTSW 11 97677222 missense probably damaging 0.99
R2258:Mllt6 UTSW 11 97664976 missense probably damaging 1.00
R2259:Mllt6 UTSW 11 97664976 missense probably damaging 1.00
R2927:Mllt6 UTSW 11 97680776 missense probably damaging 0.98
R4866:Mllt6 UTSW 11 97674459 missense probably damaging 1.00
R4938:Mllt6 UTSW 11 97678407 missense probably benign
R5058:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5064:Mllt6 UTSW 11 97673949 missense probably damaging 1.00
R5076:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5115:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5379:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5509:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5510:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5511:Mllt6 UTSW 11 97669500 missense possibly damaging 0.83
R5603:Mllt6 UTSW 11 97673505 missense probably damaging 1.00
R5816:Mllt6 UTSW 11 97672574 missense probably damaging 0.97
R6030:Mllt6 UTSW 11 97677225 missense probably damaging 0.99
R6030:Mllt6 UTSW 11 97677225 missense probably damaging 0.99
R6051:Mllt6 UTSW 11 97680743 nonsense probably null
R6180:Mllt6 UTSW 11 97678536 missense possibly damaging 0.85
R6277:Mllt6 UTSW 11 97673948 missense probably damaging 1.00
R6667:Mllt6 UTSW 11 97676934 missense probably damaging 1.00
R6754:Mllt6 UTSW 11 97674447 missense probably damaging 1.00
R6791:Mllt6 UTSW 11 97680602 missense probably damaging 0.98
R7049:Mllt6 UTSW 11 97673811 missense probably damaging 1.00
R7194:Mllt6 UTSW 11 97673568 missense probably benign 0.23
R7387:Mllt6 UTSW 11 97674600 missense probably benign 0.04
R7484:Mllt6 UTSW 11 97672616 missense probably benign 0.18
R7685:Mllt6 UTSW 11 97676964 missense probably damaging 0.99
R7853:Mllt6 UTSW 11 97670316 missense probably benign
R7862:Mllt6 UTSW 11 97665805 missense probably benign 0.03
R8004:Mllt6 UTSW 11 97676140 missense possibly damaging 0.91
Z1177:Mllt6 UTSW 11 97676425 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GCTTTAGGATAGCTAGGCTGAG -3'
(R):5'- TCTCTGGAAAGAAGCCCATGAG -3'

Sequencing Primer
(F):5'- CGGAGTGTCATGGCAGAC -3'
(R):5'- CATGAGAGAGCGGGTCTTCAC -3'
Posted On2016-06-21