Mutagenetix > Incidental Mutations

Incidental Mutation 'R5039:Mllt6'

List |< first << previous [record 32 of 53] next >> last >|

395715

Institutional Source

Beutler Lab

Gene Symbol

Mllt6

Ensembl Gene

ENSMUSG00000038437

Gene Name

myeloid/lymphoid or mixed-lineage leukemia; translocated to, 6

Synonyms

Af17

MMRRC Submission

042629-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5039 (G1)

Quality Score

121

Status

Validated

Chromosome

Chromosomal Location

97663414-97685463 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 97669500 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 210 (S210N)

Ref Sequence

ENSEMBL: ENSMUSP00000045445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044730] [ENSMUST00000107586]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044730
AA Change: S210N

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000045445
Gene: ENSMUSG00000038437
AA Change: S210N

Domain	Start	End	E-Value	Type
PHD	7	55	5.92e-7	SMART
PHD	119	178	5e-5	SMART
low complexity region	190	224	N/A	INTRINSIC
low complexity region	271	284	N/A	INTRINSIC
low complexity region	290	330	N/A	INTRINSIC
low complexity region	358	380	N/A	INTRINSIC
low complexity region	398	412	N/A	INTRINSIC
low complexity region	487	498	N/A	INTRINSIC
low complexity region	502	516	N/A	INTRINSIC
low complexity region	520	536	N/A	INTRINSIC
low complexity region	559	573	N/A	INTRINSIC
low complexity region	579	601	N/A	INTRINSIC
low complexity region	649	666	N/A	INTRINSIC
coiled coil region	703	744	N/A	INTRINSIC
low complexity region	746	756	N/A	INTRINSIC
low complexity region	773	782	N/A	INTRINSIC
low complexity region	802	848	N/A	INTRINSIC
low complexity region	860	901	N/A	INTRINSIC
coiled coil region	915	942	N/A	INTRINSIC
low complexity region	995	1018	N/A	INTRINSIC
low complexity region	1026	1037	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107586
AA Change: S210N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000103212
Gene: ENSMUSG00000038437
AA Change: S210N

Domain	Start	End	E-Value	Type
PHD	7	55	5.92e-7	SMART
PHD	119	178	5e-5	SMART
low complexity region	190	224	N/A	INTRINSIC
low complexity region	271	284	N/A	INTRINSIC
low complexity region	290	330	N/A	INTRINSIC
low complexity region	336	356	N/A	INTRINSIC
low complexity region	388	410	N/A	INTRINSIC
low complexity region	428	442	N/A	INTRINSIC
low complexity region	517	528	N/A	INTRINSIC
low complexity region	532	546	N/A	INTRINSIC
low complexity region	550	566	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
low complexity region	609	631	N/A	INTRINSIC
low complexity region	679	696	N/A	INTRINSIC
coiled coil region	733	774	N/A	INTRINSIC
low complexity region	776	786	N/A	INTRINSIC
low complexity region	803	812	N/A	INTRINSIC
low complexity region	832	878	N/A	INTRINSIC
low complexity region	890	931	N/A	INTRINSIC
coiled coil region	945	972	N/A	INTRINSIC
low complexity region	1025	1048	N/A	INTRINSIC
low complexity region	1056	1067	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134158

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155835

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit no abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	C	17: 33,067,760	C23G	probably damaging	Het
Abcg4	G	A	9: 44,281,566	A161V	probably damaging	Het
Anapc2	T	C	2: 25,274,796	I64T	possibly damaging	Het
Arfgef1	T	C	1: 10,199,736	D396G	probably benign	Het
Axl	C	T	7: 25,785,915	V163M	probably damaging	Het
Blm	G	A	7: 80,505,873	P353S	possibly damaging	Het
Btaf1	T	C	19: 36,990,762	Y1116H	probably benign	Het
Ccdc18	T	A	5: 108,158,648		probably null	Het
Ccdc87	T	C	19: 4,840,401		probably null	Het
Cdhr1	T	C	14: 37,079,643	N781S	probably benign	Het
Ctr9	C	A	7: 111,042,857	H297Q	probably benign	Het
Cyp2c55	A	G	19: 39,038,143	D398G	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dnmt3l	T	C	10: 78,052,900		probably null	Het
Dock4	C	A	12: 40,817,746	N1440K	probably damaging	Het
Etnk1	T	A	6: 143,195,317		probably null	Het
Fam120a	A	T	13: 48,910,250		probably null	Het
Fanca	T	C	8: 123,284,046	D908G	probably benign	Het
Gm17535	T	A	9: 3,035,786	L218H	probably benign	Het
Gm3633	A	C	14: 42,639,204	N42K	possibly damaging	Het
Gm4781	C	A	10: 100,396,989		noncoding transcript	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Gpr139	A	G	7: 119,144,942	V140A	probably benign	Het
Ighv1-62-3	G	T	12: 115,461,394	T13K	probably benign	Het
Itgb2l	T	C	16: 96,425,005	T629A	possibly damaging	Het
Kcnb2	T	C	1: 15,709,500	S199P	probably damaging	Het
Kdm1b	G	A	13: 47,077,486	G663D	probably damaging	Het
Lama1	A	G	17: 67,745,893	D407G	possibly damaging	Het
Macf1	T	C	4: 123,511,220	K391R	probably damaging	Het
Magi3	A	T	3: 104,105,791	S127T	probably damaging	Het
Map2	A	T	1: 66,438,796	D1759V	probably damaging	Het
Myrfl	T	C	10: 116,822,711	D447G	probably damaging	Het
Ndufb7	A	G	8: 83,571,465		probably benign	Het
Nt5e	T	A	9: 88,363,581	N301K	probably benign	Het
Olfr944	T	A	9: 39,218,114	Y252*	probably null	Het
Olfr960	A	T	9: 39,623,560	T146S	possibly damaging	Het
Pcdh10	A	G	3: 45,381,861	N870S	probably damaging	Het
Pcdh18	A	G	3: 49,754,856	V670A	probably benign	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Ric3	G	C	7: 109,038,723	S274R	probably benign	Het
Rimbp3	A	G	16: 17,213,331	T1540A	probably damaging	Het
Rnf165	A	G	18: 77,462,912	S107P	probably damaging	Het
Rp1l1	A	T	14: 64,031,356	M1464L	probably benign	Het
Slc41a3	A	G	6: 90,626,417	Y140C	probably damaging	Het
Ssb	A	T	2: 69,866,237	E38D	possibly damaging	Het
Syt14	A	T	1: 193,026,984	I16N	probably damaging	Het
Tet3	T	C	6: 83,375,896	T973A	probably damaging	Het
Tial1	T	C	7: 128,443,968		probably benign	Het
Tnfrsf1a	A	G	6: 125,360,712	T89A	possibly damaging	Het
Trpv5	T	C	6: 41,675,945	Y98C	possibly damaging	Het
Ylpm1	T	A	12: 85,015,493	S265T	probably damaging	Het
Ylpm1	A	G	12: 85,042,239	D1006G	probably damaging	Het

Other mutations in Mllt6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01745:Mllt6	APN	11	97676928	missense	probably damaging	1.00
IGL01808:Mllt6	APN	11	97672484	missense	possibly damaging	0.88
IGL01967:Mllt6	APN	11	97674777	missense	probably damaging	0.98
IGL02247:Mllt6	APN	11	97670332	missense	probably benign	0.01
IGL03161:Mllt6	APN	11	97667151	missense	probably benign	0.03
R0284:Mllt6	UTSW	11	97678605	missense	probably benign	0.02
R0718:Mllt6	UTSW	11	97676359	splice site	probably benign
R0783:Mllt6	UTSW	11	97665745	missense	probably damaging	0.99
R0811:Mllt6	UTSW	11	97678561	missense	probably damaging	0.97
R0812:Mllt6	UTSW	11	97678561	missense	probably damaging	0.97
R0904:Mllt6	UTSW	11	97664998	missense	probably damaging	1.00
R0960:Mllt6	UTSW	11	97664946	splice site	probably benign
R1445:Mllt6	UTSW	11	97672451	splice site	probably benign
R1523:Mllt6	UTSW	11	97665023	missense	probably damaging	1.00
R1781:Mllt6	UTSW	11	97672569	missense	probably benign
R1952:Mllt6	UTSW	11	97677222	missense	probably damaging	0.99
R2258:Mllt6	UTSW	11	97664976	missense	probably damaging	1.00
R2259:Mllt6	UTSW	11	97664976	missense	probably damaging	1.00
R2927:Mllt6	UTSW	11	97680776	missense	probably damaging	0.98
R4866:Mllt6	UTSW	11	97674459	missense	probably damaging	1.00
R4938:Mllt6	UTSW	11	97678407	missense	probably benign
R5058:Mllt6	UTSW	11	97669500	missense	possibly damaging	0.83
R5064:Mllt6	UTSW	11	97673949	missense	probably damaging	1.00
R5076:Mllt6	UTSW	11	97669500	missense	possibly damaging	0.83
R5115:Mllt6	UTSW	11	97669500	missense	possibly damaging	0.83
R5379:Mllt6	UTSW	11	97669500	missense	possibly damaging	0.83
R5509:Mllt6	UTSW	11	97669500	missense	possibly damaging	0.83
R5510:Mllt6	UTSW	11	97669500	missense	possibly damaging	0.83
R5511:Mllt6	UTSW	11	97669500	missense	possibly damaging	0.83
R5603:Mllt6	UTSW	11	97673505	missense	probably damaging	1.00
R5816:Mllt6	UTSW	11	97672574	missense	probably damaging	0.97
R6030:Mllt6	UTSW	11	97677225	missense	probably damaging	0.99
R6030:Mllt6	UTSW	11	97677225	missense	probably damaging	0.99
R6051:Mllt6	UTSW	11	97680743	nonsense	probably null
R6180:Mllt6	UTSW	11	97678536	missense	possibly damaging	0.85
R6277:Mllt6	UTSW	11	97673948	missense	probably damaging	1.00
R6667:Mllt6	UTSW	11	97676934	missense	probably damaging	1.00
R6754:Mllt6	UTSW	11	97674447	missense	probably damaging	1.00
R6791:Mllt6	UTSW	11	97680602	missense	probably damaging	0.98
R7049:Mllt6	UTSW	11	97673811	missense	probably damaging	1.00
R7194:Mllt6	UTSW	11	97673568	missense	probably benign	0.23
R7387:Mllt6	UTSW	11	97674600	missense	probably benign	0.04
R7484:Mllt6	UTSW	11	97672616	missense	probably benign	0.18
R7685:Mllt6	UTSW	11	97676964	missense	probably damaging	0.99
R7853:Mllt6	UTSW	11	97670316	missense	probably benign
R7862:Mllt6	UTSW	11	97665805	missense	probably benign	0.03
R8004:Mllt6	UTSW	11	97676140	missense	possibly damaging	0.91
R8498:Mllt6	UTSW	11	97676862
Z1177:Mllt6	UTSW	11	97676425	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- GCTTTAGGATAGCTAGGCTGAG -3'
(R):5'- TCTCTGGAAAGAAGCCCATGAG -3'

Sequencing Primer
(F):5'- CGGAGTGTCATGGCAGAC -3'
(R):5'- CATGAGAGAGCGGGTCTTCAC -3'

Posted On

2016-06-21