Mutagenetix > Incidental Mutation

Incidental Mutation 'R5039:Dock4'

395716

Institutional Source

Beutler Lab

Gene Symbol

Dock4

Ensembl Gene

ENSMUSG00000035954

Gene Name

dedicator of cytokinesis 4

Synonyms

EST N28122, 6330411N01Rik

MMRRC Submission

042629-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.213) question?

Stock #

R5039 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40445952-40846874 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 40817746 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1440 (N1440K)

Ref Sequence

ENSEMBL: ENSMUSP00000152420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]

AlphaFold

P59764

Predicted Effect

probably damaging
Transcript: ENSMUST00000037488
AA Change: N1440K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: N1440K

Domain	Start	End	E-Value	Type
SH3	9	66	7.29e-10	SMART
Pfam:DOCK_N	69	392	8.2e-110	PFAM
Pfam:DOCK-C2	397	583	1.9e-55	PFAM
low complexity region	829	842	N/A	INTRINSIC
Pfam:DHR-2	1092	1596	5e-108	PFAM
low complexity region	1651	1664	N/A	INTRINSIC
low complexity region	1681	1696	N/A	INTRINSIC
low complexity region	1700	1713	N/A	INTRINSIC
low complexity region	1842	1872	N/A	INTRINSIC
low complexity region	1883	1896	N/A	INTRINSIC
low complexity region	1940	1950	N/A	INTRINSIC
low complexity region	1958	1973	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000220912
AA Change: N1440K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	C	17: 33,067,760	C23G	probably damaging	Het
Abcg4	G	A	9: 44,281,566	A161V	probably damaging	Het
Anapc2	T	C	2: 25,274,796	I64T	possibly damaging	Het
Arfgef1	T	C	1: 10,199,736	D396G	probably benign	Het
Axl	C	T	7: 25,785,915	V163M	probably damaging	Het
Blm	G	A	7: 80,505,873	P353S	possibly damaging	Het
Btaf1	T	C	19: 36,990,762	Y1116H	probably benign	Het
Ccdc18	T	A	5: 108,158,648		probably null	Het
Ccdc87	T	C	19: 4,840,401		probably null	Het
Cdhr1	T	C	14: 37,079,643	N781S	probably benign	Het
Ctr9	C	A	7: 111,042,857	H297Q	probably benign	Het
Cyp2c55	A	G	19: 39,038,143	D398G	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dnmt3l	T	C	10: 78,052,900		probably null	Het
Etnk1	T	A	6: 143,195,317		probably null	Het
Fam120a	A	T	13: 48,910,250		probably null	Het
Fanca	T	C	8: 123,284,046	D908G	probably benign	Het
Gm17535	T	A	9: 3,035,786	L218H	probably benign	Het
Gm3633	A	C	14: 42,639,204	N42K	possibly damaging	Het
Gm4781	C	A	10: 100,396,989		noncoding transcript	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Gpr139	A	G	7: 119,144,942	V140A	probably benign	Het
Ighv1-62-3	G	T	12: 115,461,394	T13K	probably benign	Het
Itgb2l	T	C	16: 96,425,005	T629A	possibly damaging	Het
Kcnb2	T	C	1: 15,709,500	S199P	probably damaging	Het
Kdm1b	G	A	13: 47,077,486	G663D	probably damaging	Het
Lama1	A	G	17: 67,745,893	D407G	possibly damaging	Het
Macf1	T	C	4: 123,511,220	K391R	probably damaging	Het
Magi3	A	T	3: 104,105,791	S127T	probably damaging	Het
Map2	A	T	1: 66,438,796	D1759V	probably damaging	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Myrfl	T	C	10: 116,822,711	D447G	probably damaging	Het
Ndufb7	A	G	8: 83,571,465		probably benign	Het
Nt5e	T	A	9: 88,363,581	N301K	probably benign	Het
Olfr944	T	A	9: 39,218,114	Y252*	probably null	Het
Olfr960	A	T	9: 39,623,560	T146S	possibly damaging	Het
Pcdh10	A	G	3: 45,381,861	N870S	probably damaging	Het
Pcdh18	A	G	3: 49,754,856	V670A	probably benign	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Ric3	G	C	7: 109,038,723	S274R	probably benign	Het
Rimbp3	A	G	16: 17,213,331	T1540A	probably damaging	Het
Rnf165	A	G	18: 77,462,912	S107P	probably damaging	Het
Rp1l1	A	T	14: 64,031,356	M1464L	probably benign	Het
Slc41a3	A	G	6: 90,626,417	Y140C	probably damaging	Het
Ssb	A	T	2: 69,866,237	E38D	possibly damaging	Het
Syt14	A	T	1: 193,026,984	I16N	probably damaging	Het
Tet3	T	C	6: 83,375,896	T973A	probably damaging	Het
Tial1	T	C	7: 128,443,968		probably benign	Het
Tnfrsf1a	A	G	6: 125,360,712	T89A	possibly damaging	Het
Trpv5	T	C	6: 41,675,945	Y98C	possibly damaging	Het
Ylpm1	T	A	12: 85,015,493	S265T	probably damaging	Het
Ylpm1	A	G	12: 85,042,239	D1006G	probably damaging	Het

Other mutations in Dock4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Dock4	APN	12	40832306	missense	possibly damaging	0.48
IGL00726:Dock4	APN	12	40790068	splice site	probably benign
IGL00790:Dock4	APN	12	40834391	missense	probably damaging	1.00
IGL01061:Dock4	APN	12	40702969	missense	probably benign	0.01
IGL01083:Dock4	APN	12	40788381	splice site	probably benign
IGL01412:Dock4	APN	12	40730041	splice site	probably benign
IGL01583:Dock4	APN	12	40810467	nonsense	probably null
IGL01603:Dock4	APN	12	40693031	missense	probably damaging	1.00
IGL01766:Dock4	APN	12	40446379	nonsense	probably null
IGL02067:Dock4	APN	12	40834385	missense	probably damaging	1.00
IGL02302:Dock4	APN	12	40725777	missense	probably damaging	1.00
IGL02406:Dock4	APN	12	40777207	missense	probably benign	0.01
IGL02547:Dock4	APN	12	40737479	missense	probably benign
IGL02613:Dock4	APN	12	40810466	missense	probably damaging	1.00
IGL02643:Dock4	APN	12	40668430	missense	probably damaging	1.00
IGL02952:Dock4	APN	12	40710903	critical splice donor site	probably null
IGL02994:Dock4	APN	12	40779160	missense	probably damaging	0.99
IGL03096:Dock4	APN	12	40748001	missense	probably benign	0.00
IGL03144:Dock4	APN	12	40692907	splice site	probably benign
IGL03223:Dock4	APN	12	40817594	missense	probably damaging	1.00
IGL03296:Dock4	APN	12	40733257	missense	possibly damaging	0.84
IGL03349:Dock4	APN	12	40733310	missense	probably benign	0.42
IGL03353:Dock4	APN	12	40817758	splice site	probably null
BB005:Dock4	UTSW	12	40788303	missense	probably damaging	0.98
BB015:Dock4	UTSW	12	40788303	missense	probably damaging	0.98
R0046:Dock4	UTSW	12	40737360	splice site	probably benign
R0046:Dock4	UTSW	12	40737360	splice site	probably benign
R0110:Dock4	UTSW	12	40621312	splice site	probably benign
R0238:Dock4	UTSW	12	40737540	missense	probably damaging	0.98
R0238:Dock4	UTSW	12	40737540	missense	probably damaging	0.98
R0239:Dock4	UTSW	12	40737540	missense	probably damaging	0.98
R0239:Dock4	UTSW	12	40737540	missense	probably damaging	0.98
R0472:Dock4	UTSW	12	40838438	intron	probably benign
R0616:Dock4	UTSW	12	40704415	missense	probably benign	0.31
R0647:Dock4	UTSW	12	40710884	missense	probably damaging	1.00
R0706:Dock4	UTSW	12	40702923	missense	probably damaging	0.98
R0791:Dock4	UTSW	12	40704481	missense	probably damaging	1.00
R0940:Dock4	UTSW	12	40631627	splice site	probably benign
R1087:Dock4	UTSW	12	40729938	missense	probably benign	0.40
R1180:Dock4	UTSW	12	40640414	missense	possibly damaging	0.52
R1194:Dock4	UTSW	12	40829616	missense	probably damaging	1.00
R1463:Dock4	UTSW	12	40816325	frame shift	probably null
R1468:Dock4	UTSW	12	40755810	missense	probably benign	0.00
R1468:Dock4	UTSW	12	40755810	missense	probably benign	0.00
R1523:Dock4	UTSW	12	40693025	missense	possibly damaging	0.88
R1616:Dock4	UTSW	12	40669045	missense	probably damaging	0.99
R1682:Dock4	UTSW	12	40725780	missense	probably damaging	1.00
R1691:Dock4	UTSW	12	40725755	missense	probably benign	0.26
R1693:Dock4	UTSW	12	40834722	missense	probably benign	0.07
R1737:Dock4	UTSW	12	40807001	splice site	probably null
R1802:Dock4	UTSW	12	40794598	missense	possibly damaging	0.90
R1813:Dock4	UTSW	12	40636228	missense	probably damaging	1.00
R1846:Dock4	UTSW	12	40733268	missense	probably benign	0.00
R1959:Dock4	UTSW	12	40710798	missense	probably damaging	1.00
R1975:Dock4	UTSW	12	40779642	splice site	probably benign
R1986:Dock4	UTSW	12	40730063	missense	probably damaging	1.00
R2105:Dock4	UTSW	12	40692989	missense	probably benign	0.00
R2134:Dock4	UTSW	12	40745668	missense	probably benign
R2135:Dock4	UTSW	12	40745668	missense	probably benign
R2154:Dock4	UTSW	12	40820662	missense	probably damaging	1.00
R2154:Dock4	UTSW	12	40844548	small insertion	probably benign
R2864:Dock4	UTSW	12	40730073	missense	probably damaging	1.00
R2890:Dock4	UTSW	12	40623801	critical splice acceptor site	probably null
R3086:Dock4	UTSW	12	40731863	missense	probably benign	0.02
R3808:Dock4	UTSW	12	40672810	missense	probably damaging	0.99
R3811:Dock4	UTSW	12	40779124	missense	possibly damaging	0.87
R3836:Dock4	UTSW	12	40794624	critical splice donor site	probably null
R3838:Dock4	UTSW	12	40794624	critical splice donor site	probably null
R4091:Dock4	UTSW	12	40844267	missense	probably damaging	0.99
R4735:Dock4	UTSW	12	40631526	missense	probably benign	0.31
R4752:Dock4	UTSW	12	40446365	missense	probably benign	0.04
R4828:Dock4	UTSW	12	40668437	missense	probably damaging	1.00
R5092:Dock4	UTSW	12	40844441	missense	probably benign
R5146:Dock4	UTSW	12	40649492	splice site	probably null
R5213:Dock4	UTSW	12	40676742	missense	probably damaging	1.00
R5214:Dock4	UTSW	12	40704466	missense	probably benign	0.00
R5270:Dock4	UTSW	12	40733271	missense	probably benign	0.02
R5426:Dock4	UTSW	12	40745745	missense	probably damaging	1.00
R5474:Dock4	UTSW	12	40745731	missense	probably benign
R5544:Dock4	UTSW	12	40834702	missense	possibly damaging	0.87
R5615:Dock4	UTSW	12	40649480	missense	probably benign	0.22
R5649:Dock4	UTSW	12	40844540	missense	probably benign	0.03
R5702:Dock4	UTSW	12	40737491	missense	probably benign	0.02
R5846:Dock4	UTSW	12	40817736	missense	probably damaging	1.00
R5847:Dock4	UTSW	12	40621251	missense	probably damaging	0.97
R5895:Dock4	UTSW	12	40755813	missense	probably damaging	1.00
R5997:Dock4	UTSW	12	40755834	missense	probably damaging	0.99
R6011:Dock4	UTSW	12	40817757	critical splice donor site	probably null
R6022:Dock4	UTSW	12	40748110	missense	probably benign	0.04
R6038:Dock4	UTSW	12	40733351	splice site	probably null
R6038:Dock4	UTSW	12	40733351	splice site	probably null
R6179:Dock4	UTSW	12	40731869	missense	probably benign	0.00
R6479:Dock4	UTSW	12	40828955	missense	probably damaging	1.00
R6516:Dock4	UTSW	12	40731899	missense	possibly damaging	0.94
R6748:Dock4	UTSW	12	40704466	missense	probably benign	0.44
R6752:Dock4	UTSW	12	40820617	missense	probably damaging	1.00
R6814:Dock4	UTSW	12	40812326	critical splice donor site	probably null
R6864:Dock4	UTSW	12	40745746	missense	probably damaging	1.00
R6872:Dock4	UTSW	12	40812326	critical splice donor site	probably null
R6891:Dock4	UTSW	12	40779136	missense	probably damaging	1.00
R6937:Dock4	UTSW	12	40834635	missense	probably benign	0.01
R6950:Dock4	UTSW	12	40733314	missense	possibly damaging	0.80
R7081:Dock4	UTSW	12	40621286	missense	probably damaging	1.00
R7129:Dock4	UTSW	12	40828879	missense	probably damaging	1.00
R7140:Dock4	UTSW	12	40636159	missense	probably benign	0.06
R7241:Dock4	UTSW	12	40794860	missense	probably damaging	1.00
R7378:Dock4	UTSW	12	40788244	missense	possibly damaging	0.94
R7714:Dock4	UTSW	12	40725649	nonsense	probably null
R7720:Dock4	UTSW	12	40806975	missense	probably damaging	0.99
R7756:Dock4	UTSW	12	40710879	missense	probably benign	0.02
R7758:Dock4	UTSW	12	40710879	missense	probably benign	0.02
R7759:Dock4	UTSW	12	40817736	missense	probably damaging	1.00
R7787:Dock4	UTSW	12	40725677	missense	probably benign
R7879:Dock4	UTSW	12	40730084	missense	possibly damaging	0.76
R7928:Dock4	UTSW	12	40788303	missense	probably damaging	0.98
R8000:Dock4	UTSW	12	40833119	missense	probably benign	0.05
R8042:Dock4	UTSW	12	40745760	missense	probably benign	0.01
R8231:Dock4	UTSW	12	40702951	missense	possibly damaging	0.88
R8234:Dock4	UTSW	12	40834838	splice site	probably null
R8758:Dock4	UTSW	12	40788232	missense	probably benign	0.12
R8871:Dock4	UTSW	12	40745731	missense	probably benign
R8873:Dock4	UTSW	12	40676768	nonsense	probably null
R8884:Dock4	UTSW	12	40806885	missense	probably damaging	1.00
R9164:Dock4	UTSW	12	40704338	missense	probably damaging	1.00
R9225:Dock4	UTSW	12	40829670	missense	probably benign	0.02
R9276:Dock4	UTSW	12	40649405	missense	possibly damaging	0.48
R9307:Dock4	UTSW	12	40636156	missense	probably damaging	1.00
R9675:Dock4	UTSW	12	40844380	small insertion	probably benign
R9675:Dock4	UTSW	12	40844394	small insertion	probably benign
R9676:Dock4	UTSW	12	40844380	small insertion	probably benign
R9676:Dock4	UTSW	12	40844388	small insertion	probably benign
R9676:Dock4	UTSW	12	40844398	small insertion	probably benign
R9676:Dock4	UTSW	12	40844402	small insertion	probably benign
R9678:Dock4	UTSW	12	40844380	small insertion	probably benign
R9678:Dock4	UTSW	12	40844388	small insertion	probably benign
R9678:Dock4	UTSW	12	40844397	small insertion	probably benign
R9691:Dock4	UTSW	12	40636098	missense	probably damaging	1.00
RF018:Dock4	UTSW	12	40844399	frame shift	probably null
RF025:Dock4	UTSW	12	40844393	frame shift	probably null
RF063:Dock4	UTSW	12	40844399	frame shift	probably null
X0028:Dock4	UTSW	12	40669047	missense	probably benign	0.25
Z1176:Dock4	UTSW	12	40631614	missense	probably benign	0.01
Z1176:Dock4	UTSW	12	40631616	missense	probably benign	0.16
Z1177:Dock4	UTSW	12	40817641	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ATTTGTCAAGCCGGGTTTCC -3'
(R):5'- GGGACCAAAACTCTTCTTGCTTAG -3'

Sequencing Primer
(F):5'- AAGCCGGGTTTCCTCCTTGAC -3'
(R):5'- GAAAATGTTTCCCGTCACTTGG -3'

Posted On

2016-06-21