Incidental Mutation 'R5039:Fam120a'
ID395722
Institutional Source Beutler Lab
Gene Symbol Fam120a
Ensembl Gene ENSMUSG00000038014
Gene Namefamily with sequence similarity 120, member A
Synonyms
MMRRC Submission 042629-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5039 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location48879219-48968017 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 48910250 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000053877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060805] [ENSMUST00000060805]
Predicted Effect probably null
Transcript: ENSMUST00000060805
SMART Domains Protein: ENSMUSP00000053877
Gene: ENSMUSG00000038014

DomainStartEndE-ValueType
Blast:XPGN 1 112 1e-15 BLAST
low complexity region 348 361 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 852 866 N/A INTRINSIC
low complexity region 881 897 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
low complexity region 972 986 N/A INTRINSIC
low complexity region 996 1006 N/A INTRINSIC
low complexity region 1026 1044 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000060805
SMART Domains Protein: ENSMUSP00000053877
Gene: ENSMUSG00000038014

DomainStartEndE-ValueType
Blast:XPGN 1 112 1e-15 BLAST
low complexity region 348 361 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 852 866 N/A INTRINSIC
low complexity region 881 897 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
low complexity region 972 986 N/A INTRINSIC
low complexity region 996 1006 N/A INTRINSIC
low complexity region 1026 1044 N/A INTRINSIC
Meta Mutation Damage Score 0.8461 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,760 C23G probably damaging Het
Abcg4 G A 9: 44,281,566 A161V probably damaging Het
Anapc2 T C 2: 25,274,796 I64T possibly damaging Het
Arfgef1 T C 1: 10,199,736 D396G probably benign Het
Axl C T 7: 25,785,915 V163M probably damaging Het
Blm G A 7: 80,505,873 P353S possibly damaging Het
Btaf1 T C 19: 36,990,762 Y1116H probably benign Het
Ccdc18 T A 5: 108,158,648 probably null Het
Ccdc87 T C 19: 4,840,401 probably null Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ctr9 C A 7: 111,042,857 H297Q probably benign Het
Cyp2c55 A G 19: 39,038,143 D398G probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnmt3l T C 10: 78,052,900 probably null Het
Dock4 C A 12: 40,817,746 N1440K probably damaging Het
Etnk1 T A 6: 143,195,317 probably null Het
Fanca T C 8: 123,284,046 D908G probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3633 A C 14: 42,639,204 N42K possibly damaging Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gpr139 A G 7: 119,144,942 V140A probably benign Het
Ighv1-62-3 G T 12: 115,461,394 T13K probably benign Het
Itgb2l T C 16: 96,425,005 T629A possibly damaging Het
Kcnb2 T C 1: 15,709,500 S199P probably damaging Het
Kdm1b G A 13: 47,077,486 G663D probably damaging Het
Lama1 A G 17: 67,745,893 D407G possibly damaging Het
Macf1 T C 4: 123,511,220 K391R probably damaging Het
Magi3 A T 3: 104,105,791 S127T probably damaging Het
Map2 A T 1: 66,438,796 D1759V probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myrfl T C 10: 116,822,711 D447G probably damaging Het
Ndufb7 A G 8: 83,571,465 probably benign Het
Nt5e T A 9: 88,363,581 N301K probably benign Het
Olfr944 T A 9: 39,218,114 Y252* probably null Het
Olfr960 A T 9: 39,623,560 T146S possibly damaging Het
Pcdh10 A G 3: 45,381,861 N870S probably damaging Het
Pcdh18 A G 3: 49,754,856 V670A probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ric3 G C 7: 109,038,723 S274R probably benign Het
Rimbp3 A G 16: 17,213,331 T1540A probably damaging Het
Rnf165 A G 18: 77,462,912 S107P probably damaging Het
Rp1l1 A T 14: 64,031,356 M1464L probably benign Het
Slc41a3 A G 6: 90,626,417 Y140C probably damaging Het
Ssb A T 2: 69,866,237 E38D possibly damaging Het
Syt14 A T 1: 193,026,984 I16N probably damaging Het
Tet3 T C 6: 83,375,896 T973A probably damaging Het
Tial1 T C 7: 128,443,968 probably benign Het
Tnfrsf1a A G 6: 125,360,712 T89A possibly damaging Het
Trpv5 T C 6: 41,675,945 Y98C possibly damaging Het
Ylpm1 T A 12: 85,015,493 S265T probably damaging Het
Ylpm1 A G 12: 85,042,239 D1006G probably damaging Het
Other mutations in Fam120a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Fam120a APN 13 48889133 missense probably benign
IGL01087:Fam120a APN 13 48902073 missense probably damaging 1.00
IGL02052:Fam120a APN 13 48933945 splice site probably benign
IGL02409:Fam120a APN 13 48967359 missense probably benign 0.05
IGL03172:Fam120a APN 13 48910336 missense probably damaging 1.00
bumped UTSW 13 48892021 missense probably benign 0.07
Green_flash UTSW 13 48891964 missense probably damaging 1.00
Sunset UTSW 13 48910250 splice site probably null
upended UTSW 13 48897667 missense probably damaging 1.00
R0036:Fam120a UTSW 13 48889264 splice site probably benign
R0042:Fam120a UTSW 13 48934014 missense probably damaging 1.00
R0689:Fam120a UTSW 13 48967638 missense probably damaging 1.00
R0741:Fam120a UTSW 13 48891940 missense possibly damaging 0.91
R0899:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0900:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0987:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0989:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0990:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1080:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1121:Fam120a UTSW 13 48910437 splice site probably null
R1265:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1423:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1611:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1755:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1888:Fam120a UTSW 13 48885866 missense possibly damaging 0.50
R1888:Fam120a UTSW 13 48885866 missense possibly damaging 0.50
R2041:Fam120a UTSW 13 48897767 missense probably benign 0.01
R2433:Fam120a UTSW 13 48933968 missense probably damaging 1.00
R2496:Fam120a UTSW 13 48967593 missense probably damaging 0.99
R3122:Fam120a UTSW 13 48892086 missense possibly damaging 0.45
R4279:Fam120a UTSW 13 48889258 missense probably benign 0.00
R4758:Fam120a UTSW 13 48880857 missense probably benign 0.02
R4924:Fam120a UTSW 13 48902096 missense probably benign 0.04
R5000:Fam120a UTSW 13 48897667 missense probably damaging 1.00
R5194:Fam120a UTSW 13 48880935 missense probably benign
R5772:Fam120a UTSW 13 48880933 missense probably benign
R6765:Fam120a UTSW 13 48891964 missense probably damaging 1.00
R6820:Fam120a UTSW 13 48880992 missense possibly damaging 0.51
R6833:Fam120a UTSW 13 48934041 missense probably damaging 1.00
R6895:Fam120a UTSW 13 48892021 missense probably benign 0.07
R6946:Fam120a UTSW 13 48881020 missense possibly damaging 0.83
R7032:Fam120a UTSW 13 48949113 missense probably benign 0.34
R7081:Fam120a UTSW 13 48910325 missense probably damaging 0.98
R7289:Fam120a UTSW 13 48892006 missense probably damaging 1.00
R7503:Fam120a UTSW 13 48949247 missense probably benign 0.00
R7978:Fam120a UTSW 13 48902274 missense probably damaging 1.00
R8200:Fam120a UTSW 13 48949119 missense probably damaging 0.97
R8311:Fam120a UTSW 13 48933957 missense possibly damaging 0.84
X0003:Fam120a UTSW 13 48949138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTATGGCTTCTCCTGTTCTG -3'
(R):5'- AGGCAAGTTGTTAAGCCATTGG -3'

Sequencing Primer
(F):5'- CTGTTCTGAGGGCTCGATCC -3'
(R):5'- CTTCCATGCAAAGGGTGAAATC -3'
Posted On2016-06-21