Mutagenetix > Incidental Mutations

Incidental Mutation 'R5039:Itgb2l'

List |< first << previous [record 25 of 53] next >> last >|

395727

Institutional Source

Beutler Lab

Gene Symbol

Itgb2l

Ensembl Gene

ENSMUSG00000000157

Gene Name

integrin beta 2-like

Synonyms

pactolus, 5033406G21Rik

MMRRC Submission

042629-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R5039 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96422288-96443619 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 96425005 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 629 (T629A)

Ref Sequence

ENSEMBL: ENSMUSP00000109403 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000161] [ENSMUST00000113773] [ENSMUST00000113794] [ENSMUST00000113795] [ENSMUST00000131567] [ENSMUST00000136292]

Predicted Effect

probably benign
Transcript: ENSMUST00000000161
AA Change: T629A

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000000161
Gene: ENSMUSG00000000157
AA Change: T629A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	24	63	3.95e1	SMART
PSI	24	74	2.88e-4	SMART
INB	32	419	7.05e-119	SMART
VWA	126	329	1.16e0	SMART
EGF_like	553	585	4.64e1	SMART
Integrin_B_tail	594	669	1.22e-9	SMART
transmembrane domain	672	694	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113773
AA Change: T629A

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000109403
Gene: ENSMUSG00000000157
AA Change: T629A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	24	63	3.95e1	SMART
PSI	24	74	2.88e-4	SMART
INB	32	419	7.05e-119	SMART
VWA	126	329	1.16e0	SMART
EGF_like	553	585	4.64e1	SMART
Integrin_B_tail	594	669	1.22e-9	SMART
transmembrane domain	672	694	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113794

SMART Domains

Protein: ENSMUSP00000109425
Gene: ENSMUSG00000000159

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	31	127	9.63e-6	SMART
IG	134	221	2.64e0	SMART
transmembrane domain	239	261	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113795

SMART Domains

Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	31	125	4.74e-5	SMART
transmembrane domain	139	161	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000131567

SMART Domains

Protein: ENSMUSP00000114497
Gene: ENSMUSG00000000157

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PSI	24	74	2.88e-4	SMART
INB	32	419	7.05e-119	SMART
VWA	126	329	1.16e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131777

Predicted Effect

probably benign
Transcript: ENSMUST00000136292

Meta Mutation Damage Score

0.0867

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele display normal leukocyte development and normal neutrophil recruitment to inflamed tissues. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	C	17: 33,067,760	C23G	probably damaging	Het
Abcg4	G	A	9: 44,281,566	A161V	probably damaging	Het
Anapc2	T	C	2: 25,274,796	I64T	possibly damaging	Het
Arfgef1	T	C	1: 10,199,736	D396G	probably benign	Het
Axl	C	T	7: 25,785,915	V163M	probably damaging	Het
Blm	G	A	7: 80,505,873	P353S	possibly damaging	Het
Btaf1	T	C	19: 36,990,762	Y1116H	probably benign	Het
Ccdc18	T	A	5: 108,158,648		probably null	Het
Ccdc87	T	C	19: 4,840,401		probably null	Het
Cdhr1	T	C	14: 37,079,643	N781S	probably benign	Het
Ctr9	C	A	7: 111,042,857	H297Q	probably benign	Het
Cyp2c55	A	G	19: 39,038,143	D398G	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dnmt3l	T	C	10: 78,052,900		probably null	Het
Dock4	C	A	12: 40,817,746	N1440K	probably damaging	Het
Etnk1	T	A	6: 143,195,317		probably null	Het
Fam120a	A	T	13: 48,910,250		probably null	Het
Fanca	T	C	8: 123,284,046	D908G	probably benign	Het
Gm17535	T	A	9: 3,035,786	L218H	probably benign	Het
Gm3633	A	C	14: 42,639,204	N42K	possibly damaging	Het
Gm4781	C	A	10: 100,396,989		noncoding transcript	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Gpr139	A	G	7: 119,144,942	V140A	probably benign	Het
Ighv1-62-3	G	T	12: 115,461,394	T13K	probably benign	Het
Kcnb2	T	C	1: 15,709,500	S199P	probably damaging	Het
Kdm1b	G	A	13: 47,077,486	G663D	probably damaging	Het
Lama1	A	G	17: 67,745,893	D407G	possibly damaging	Het
Macf1	T	C	4: 123,511,220	K391R	probably damaging	Het
Magi3	A	T	3: 104,105,791	S127T	probably damaging	Het
Map2	A	T	1: 66,438,796	D1759V	probably damaging	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Myrfl	T	C	10: 116,822,711	D447G	probably damaging	Het
Ndufb7	A	G	8: 83,571,465		probably benign	Het
Nt5e	T	A	9: 88,363,581	N301K	probably benign	Het
Olfr944	T	A	9: 39,218,114	Y252*	probably null	Het
Olfr960	A	T	9: 39,623,560	T146S	possibly damaging	Het
Pcdh10	A	G	3: 45,381,861	N870S	probably damaging	Het
Pcdh18	A	G	3: 49,754,856	V670A	probably benign	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Ric3	G	C	7: 109,038,723	S274R	probably benign	Het
Rimbp3	A	G	16: 17,213,331	T1540A	probably damaging	Het
Rnf165	A	G	18: 77,462,912	S107P	probably damaging	Het
Rp1l1	A	T	14: 64,031,356	M1464L	probably benign	Het
Slc41a3	A	G	6: 90,626,417	Y140C	probably damaging	Het
Ssb	A	T	2: 69,866,237	E38D	possibly damaging	Het
Syt14	A	T	1: 193,026,984	I16N	probably damaging	Het
Tet3	T	C	6: 83,375,896	T973A	probably damaging	Het
Tial1	T	C	7: 128,443,968		probably benign	Het
Tnfrsf1a	A	G	6: 125,360,712	T89A	possibly damaging	Het
Trpv5	T	C	6: 41,675,945	Y98C	possibly damaging	Het
Ylpm1	T	A	12: 85,015,493	S265T	probably damaging	Het
Ylpm1	A	G	12: 85,042,239	D1006G	probably damaging	Het

Other mutations in Itgb2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Itgb2l	APN	16	96426750	missense	probably damaging	0.98
IGL01482:Itgb2l	APN	16	96438748	missense	probably damaging	0.99
IGL01767:Itgb2l	APN	16	96430575	missense	probably benign	0.05
IGL02056:Itgb2l	APN	16	96427689	missense	probably damaging	0.97
IGL02072:Itgb2l	APN	16	96430608	missense	probably benign
IGL02858:Itgb2l	APN	16	96422650	missense	possibly damaging	0.96
R0011:Itgb2l	UTSW	16	96427661	splice site	probably benign
R0153:Itgb2l	UTSW	16	96437369	missense	possibly damaging	0.94
R0270:Itgb2l	UTSW	16	96422930	unclassified	probably benign
R0496:Itgb2l	UTSW	16	96434701	missense	possibly damaging	0.86
R0627:Itgb2l	UTSW	16	96422911	unclassified	probably benign
R1185:Itgb2l	UTSW	16	96429040	missense	possibly damaging	0.90
R1185:Itgb2l	UTSW	16	96429040	missense	possibly damaging	0.90
R1185:Itgb2l	UTSW	16	96429040	missense	possibly damaging	0.90
R1509:Itgb2l	UTSW	16	96426849	missense	probably benign	0.28
R1792:Itgb2l	UTSW	16	96425082	missense	probably damaging	1.00
R1912:Itgb2l	UTSW	16	96426935	missense	probably benign	0.17
R2210:Itgb2l	UTSW	16	96426221	missense	possibly damaging	0.82
R3160:Itgb2l	UTSW	16	96437389	missense	probably damaging	0.99
R3162:Itgb2l	UTSW	16	96437389	missense	probably damaging	0.99
R3836:Itgb2l	UTSW	16	96426167	missense	probably benign
R4131:Itgb2l	UTSW	16	96437389	missense	probably damaging	0.99
R4132:Itgb2l	UTSW	16	96437389	missense	probably damaging	0.99
R4254:Itgb2l	UTSW	16	96430577	missense	probably benign	0.00
R4854:Itgb2l	UTSW	16	96426117	nonsense	probably null
R4893:Itgb2l	UTSW	16	96427821	missense	probably benign	0.12
R4931:Itgb2l	UTSW	16	96437449	missense	probably damaging	1.00
R5055:Itgb2l	UTSW	16	96427803	missense	probably damaging	1.00
R5960:Itgb2l	UTSW	16	96426259	missense	probably benign	0.00
R6412:Itgb2l	UTSW	16	96427729	missense	probably benign	0.04
R6966:Itgb2l	UTSW	16	96430643	missense	probably benign	0.02
R7149:Itgb2l	UTSW	16	96433559	missense	probably damaging	1.00
R7278:Itgb2l	UTSW	16	96429043	missense	probably damaging	1.00
R7293:Itgb2l	UTSW	16	96426796	nonsense	probably null
R7482:Itgb2l	UTSW	16	96426833	missense	probably benign	0.01
R7570:Itgb2l	UTSW	16	96426239	missense	probably benign	0.00
R7743:Itgb2l	UTSW	16	96437408	missense	probably damaging	1.00
R7771:Itgb2l	UTSW	16	96426972	missense	probably damaging	1.00
R8446:Itgb2l	UTSW	16	96432657	missense	probably damaging	1.00
X0018:Itgb2l	UTSW	16	96435676	missense	probably benign	0.01
Z1177:Itgb2l	UTSW	16	96437356	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTTACCCATTGGAGAAGAGAC -3'
(R):5'- GCACCTTGCCCATTCATGTG -3'

Sequencing Primer
(F):5'- AGCCCTCTCGATATCTGCAGAG -3'
(R):5'- GCCCATTCATGTGGCATTTG -3'

Posted On

2016-06-21