Incidental Mutation 'R5039:Polr1c'
ID395729
Institutional Source Beutler Lab
Gene Symbol Polr1c
Ensembl Gene ENSMUSG00000067148
Gene Namepolymerase (RNA) I polypeptide C
SynonymsRPA40, Rpo1-1, 40kDa
MMRRC Submission 042629-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5039 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46243920-46248054 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 46247709 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087026] [ENSMUST00000095263] [ENSMUST00000123311] [ENSMUST00000124655] [ENSMUST00000142706] [ENSMUST00000173232] [ENSMUST00000173349]
Predicted Effect probably benign
Transcript: ENSMUST00000087026
SMART Domains Protein: ENSMUSP00000084252
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 60 339 4.53e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095263
SMART Domains Protein: ENSMUSP00000092897
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
low complexity region 59 75 N/A INTRINSIC
transmembrane domain 146 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
low complexity region 320 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123311
SMART Domains Protein: ENSMUSP00000115951
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
transmembrane domain 117 139 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124126
Predicted Effect probably benign
Transcript: ENSMUST00000124655
SMART Domains Protein: ENSMUSP00000122026
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 1 253 2.14e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127378
SMART Domains Protein: ENSMUSP00000114937
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
Pfam:Yip1 30 178 4.6e-13 PFAM
low complexity region 189 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142706
SMART Domains Protein: ENSMUSP00000116998
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 60 255 9.13e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152583
Predicted Effect probably benign
Transcript: ENSMUST00000173232
SMART Domains Protein: ENSMUSP00000133597
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
Pfam:RNA_pol_L 61 100 1.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174392
Predicted Effect probably benign
Transcript: ENSMUST00000173349
SMART Domains Protein: ENSMUSP00000133861
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 42 170 2.3e-5 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of both RNA polymerase I and RNA polymerase III complexes. The encoded protein is part of the Pol core element. Mutations in this gene have been associated with Treacher Collins syndrome (TCS) and hypomyelinating leukodystrophy 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,760 C23G probably damaging Het
Abcg4 G A 9: 44,281,566 A161V probably damaging Het
Anapc2 T C 2: 25,274,796 I64T possibly damaging Het
Arfgef1 T C 1: 10,199,736 D396G probably benign Het
Axl C T 7: 25,785,915 V163M probably damaging Het
Blm G A 7: 80,505,873 P353S possibly damaging Het
Btaf1 T C 19: 36,990,762 Y1116H probably benign Het
Ccdc18 T A 5: 108,158,648 probably null Het
Ccdc87 T C 19: 4,840,401 probably null Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ctr9 C A 7: 111,042,857 H297Q probably benign Het
Cyp2c55 A G 19: 39,038,143 D398G probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnmt3l T C 10: 78,052,900 probably null Het
Dock4 C A 12: 40,817,746 N1440K probably damaging Het
Etnk1 T A 6: 143,195,317 probably null Het
Fam120a A T 13: 48,910,250 probably null Het
Fanca T C 8: 123,284,046 D908G probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3633 A C 14: 42,639,204 N42K possibly damaging Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gpr139 A G 7: 119,144,942 V140A probably benign Het
Ighv1-62-3 G T 12: 115,461,394 T13K probably benign Het
Itgb2l T C 16: 96,425,005 T629A possibly damaging Het
Kcnb2 T C 1: 15,709,500 S199P probably damaging Het
Kdm1b G A 13: 47,077,486 G663D probably damaging Het
Lama1 A G 17: 67,745,893 D407G possibly damaging Het
Macf1 T C 4: 123,511,220 K391R probably damaging Het
Magi3 A T 3: 104,105,791 S127T probably damaging Het
Map2 A T 1: 66,438,796 D1759V probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myrfl T C 10: 116,822,711 D447G probably damaging Het
Ndufb7 A G 8: 83,571,465 probably benign Het
Nt5e T A 9: 88,363,581 N301K probably benign Het
Olfr944 T A 9: 39,218,114 Y252* probably null Het
Olfr960 A T 9: 39,623,560 T146S possibly damaging Het
Pcdh10 A G 3: 45,381,861 N870S probably damaging Het
Pcdh18 A G 3: 49,754,856 V670A probably benign Het
Ric3 G C 7: 109,038,723 S274R probably benign Het
Rimbp3 A G 16: 17,213,331 T1540A probably damaging Het
Rnf165 A G 18: 77,462,912 S107P probably damaging Het
Rp1l1 A T 14: 64,031,356 M1464L probably benign Het
Slc41a3 A G 6: 90,626,417 Y140C probably damaging Het
Ssb A T 2: 69,866,237 E38D possibly damaging Het
Syt14 A T 1: 193,026,984 I16N probably damaging Het
Tet3 T C 6: 83,375,896 T973A probably damaging Het
Tial1 T C 7: 128,443,968 probably benign Het
Tnfrsf1a A G 6: 125,360,712 T89A possibly damaging Het
Trpv5 T C 6: 41,675,945 Y98C possibly damaging Het
Ylpm1 T A 12: 85,015,493 S265T probably damaging Het
Ylpm1 A G 12: 85,042,239 D1006G probably damaging Het
Other mutations in Polr1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Polr1c APN 17 46244209 missense probably damaging 1.00
IGL02035:Polr1c APN 17 46246159 missense possibly damaging 0.72
R0068:Polr1c UTSW 17 46244903 missense probably benign 0.00
R0457:Polr1c UTSW 17 46247763 missense probably benign 0.00
R0828:Polr1c UTSW 17 46245064 missense probably damaging 0.96
R0881:Polr1c UTSW 17 46244613 missense possibly damaging 0.69
R1322:Polr1c UTSW 17 46244163 missense possibly damaging 0.74
R1518:Polr1c UTSW 17 46247895 missense possibly damaging 0.89
R3765:Polr1c UTSW 17 46247924 missense probably damaging 0.99
R4212:Polr1c UTSW 17 46246120 missense probably damaging 0.97
R4548:Polr1c UTSW 17 46247809 splice site probably null
R5017:Polr1c UTSW 17 46247709 intron probably benign
R5018:Polr1c UTSW 17 46247709 intron probably benign
R5167:Polr1c UTSW 17 46247709 intron probably benign
R5168:Polr1c UTSW 17 46247709 intron probably benign
R5971:Polr1c UTSW 17 46247709 intron probably benign
R6979:Polr1c UTSW 17 46246169 missense probably damaging 1.00
R7812:Polr1c UTSW 17 46246127 missense probably damaging 1.00
R7869:Polr1c UTSW 17 46244891 missense probably benign 0.00
R8025:Polr1c UTSW 17 46245048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGATTCAGTGCATCAATG -3'
(R):5'- GTTCGCAATGTAAGAGATCGGG -3'

Sequencing Primer
(F):5'- AGTGCATCAATGATTCCTGACC -3'
(R):5'- TGTAAGAGATCGGGGCGCG -3'
Posted On2016-06-21