Incidental Mutation 'R5039:Rnf165'
List |< first << previous [record 43 of 53] next >> last >|
ID395731
Institutional Source Beutler Lab
Gene Symbol Rnf165
Ensembl Gene ENSMUSG00000025427
Gene Namering finger protein 165
SynonymsG630064H08Rik, Ark2c, LOC225743, 2900024M11Rik
MMRRC Submission 042629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R5039 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location77456110-77565147 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77462912 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 107 (S107P)
Ref Sequence ENSEMBL: ENSMUSP00000138494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026494] [ENSMUST00000182024]
Predicted Effect probably damaging
Transcript: ENSMUST00000026494
AA Change: S300P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026494
Gene: ENSMUSG00000025427
AA Change: S300P

DomainStartEndE-ValueType
low complexity region 99 121 N/A INTRINSIC
RING 295 335 1.4e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182024
AA Change: S107P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138494
Gene: ENSMUSG00000025427
AA Change: S107P

DomainStartEndE-ValueType
RING 102 142 1.4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182805
Meta Mutation Damage Score 0.2615 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Encoded in regions involved in pericentric inversions in patients with bipolar affective disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial neonatal lethality followed by complete postnatal lethality, growth retardation, abnormal joint mobility, cyanosis, abnormal motor neuron innervation pattern and abnormal phrenic nerve innervation pattern to diaphragm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,760 C23G probably damaging Het
Abcg4 G A 9: 44,281,566 A161V probably damaging Het
Anapc2 T C 2: 25,274,796 I64T possibly damaging Het
Arfgef1 T C 1: 10,199,736 D396G probably benign Het
Axl C T 7: 25,785,915 V163M probably damaging Het
Blm G A 7: 80,505,873 P353S possibly damaging Het
Btaf1 T C 19: 36,990,762 Y1116H probably benign Het
Ccdc18 T A 5: 108,158,648 probably null Het
Ccdc87 T C 19: 4,840,401 probably null Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ctr9 C A 7: 111,042,857 H297Q probably benign Het
Cyp2c55 A G 19: 39,038,143 D398G probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnmt3l T C 10: 78,052,900 probably null Het
Dock4 C A 12: 40,817,746 N1440K probably damaging Het
Etnk1 T A 6: 143,195,317 probably null Het
Fam120a A T 13: 48,910,250 probably null Het
Fanca T C 8: 123,284,046 D908G probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3633 A C 14: 42,639,204 N42K possibly damaging Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gpr139 A G 7: 119,144,942 V140A probably benign Het
Ighv1-62-3 G T 12: 115,461,394 T13K probably benign Het
Itgb2l T C 16: 96,425,005 T629A possibly damaging Het
Kcnb2 T C 1: 15,709,500 S199P probably damaging Het
Kdm1b G A 13: 47,077,486 G663D probably damaging Het
Lama1 A G 17: 67,745,893 D407G possibly damaging Het
Macf1 T C 4: 123,511,220 K391R probably damaging Het
Magi3 A T 3: 104,105,791 S127T probably damaging Het
Map2 A T 1: 66,438,796 D1759V probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myrfl T C 10: 116,822,711 D447G probably damaging Het
Ndufb7 A G 8: 83,571,465 probably benign Het
Nt5e T A 9: 88,363,581 N301K probably benign Het
Olfr944 T A 9: 39,218,114 Y252* probably null Het
Olfr960 A T 9: 39,623,560 T146S possibly damaging Het
Pcdh10 A G 3: 45,381,861 N870S probably damaging Het
Pcdh18 A G 3: 49,754,856 V670A probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ric3 G C 7: 109,038,723 S274R probably benign Het
Rimbp3 A G 16: 17,213,331 T1540A probably damaging Het
Rp1l1 A T 14: 64,031,356 M1464L probably benign Het
Slc41a3 A G 6: 90,626,417 Y140C probably damaging Het
Ssb A T 2: 69,866,237 E38D possibly damaging Het
Syt14 A T 1: 193,026,984 I16N probably damaging Het
Tet3 T C 6: 83,375,896 T973A probably damaging Het
Tial1 T C 7: 128,443,968 probably benign Het
Tnfrsf1a A G 6: 125,360,712 T89A possibly damaging Het
Trpv5 T C 6: 41,675,945 Y98C possibly damaging Het
Ylpm1 T A 12: 85,015,493 S265T probably damaging Het
Ylpm1 A G 12: 85,042,239 D1006G probably damaging Het
Other mutations in Rnf165
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Rnf165 APN 18 77462914 missense probably damaging 1.00
IGL02014:Rnf165 APN 18 77468359 missense probably damaging 0.99
IGL03210:Rnf165 APN 18 77466739 missense probably damaging 1.00
R0486:Rnf165 UTSW 18 77484254 missense probably damaging 0.97
R1523:Rnf165 UTSW 18 77462938 missense probably benign 0.17
R1650:Rnf165 UTSW 18 77462417 splice site probably null
R1853:Rnf165 UTSW 18 77462975 missense possibly damaging 0.68
R3402:Rnf165 UTSW 18 77565086 missense probably benign 0.02
R5415:Rnf165 UTSW 18 77466739 missense probably damaging 1.00
R5875:Rnf165 UTSW 18 77563181 intron probably benign
R6544:Rnf165 UTSW 18 77563235 intron probably benign
R7873:Rnf165 UTSW 18 77466753 missense possibly damaging 0.80
X0067:Rnf165 UTSW 18 77462950 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTGCAATCATGAGACACCC -3'
(R):5'- GAGGATTTAAAGATACTGGCTCCC -3'

Sequencing Primer
(F):5'- TGCAATCATGAGACACCCTAGCAC -3'
(R):5'- CAGCGCATGGAGAGACTACC -3'
Posted On2016-06-21