Mutagenetix > Incidental Mutations

Incidental Mutation 'R5039:Btaf1'

List |< first << previous [record 7 of 53] next >> last >|

395733

Institutional Source

Beutler Lab

Gene Symbol

Btaf1

Ensembl Gene

ENSMUSG00000040565

Gene Name

B-TFIID TATA-box binding protein associated factor 1

Synonyms

E430027O22Rik

MMRRC Submission

042629-MU

Accession Numbers

Genbank: NM_001080706

Is this an essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R5039 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36926079-37012752 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36990762 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1116 (Y1116H)

Ref Sequence

ENSEMBL: ENSMUSP00000097093 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099494]

Predicted Effect

probably benign
Transcript: ENSMUST00000099494
AA Change: Y1116H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: Y1116H

Domain	Start	End	E-Value	Type
low complexity region	87	98	N/A	INTRINSIC
low complexity region	143	152	N/A	INTRINSIC
PDB:3OC3\|B	276	414	3e-6	PDB
low complexity region	438	454	N/A	INTRINSIC
Pfam:DUF3535	585	1051	1.1e-133	PFAM
low complexity region	1099	1110	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
DEXDc	1261	1469	3.02e-30	SMART
low complexity region	1630	1641	N/A	INTRINSIC
HELICc	1657	1743	2.22e-19	SMART

Meta Mutation Damage Score

0.0660

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]

Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921501E09Rik	A	C	17: 33,067,760	C23G	probably damaging	Het
Abcg4	G	A	9: 44,281,566	A161V	probably damaging	Het
Anapc2	T	C	2: 25,274,796	I64T	possibly damaging	Het
Arfgef1	T	C	1: 10,199,736	D396G	probably benign	Het
Axl	C	T	7: 25,785,915	V163M	probably damaging	Het
Blm	G	A	7: 80,505,873	P353S	possibly damaging	Het
Ccdc18	T	A	5: 108,158,648		probably null	Het
Ccdc87	T	C	19: 4,840,401		probably null	Het
Cdhr1	T	C	14: 37,079,643	N781S	probably benign	Het
Ctr9	C	A	7: 111,042,857	H297Q	probably benign	Het
Cyp2c55	A	G	19: 39,038,143	D398G	probably benign	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dnmt3l	T	C	10: 78,052,900		probably null	Het
Dock4	C	A	12: 40,817,746	N1440K	probably damaging	Het
Etnk1	T	A	6: 143,195,317		probably null	Het
Fam120a	A	T	13: 48,910,250		probably null	Het
Fanca	T	C	8: 123,284,046	D908G	probably benign	Het
Gm17535	T	A	9: 3,035,786	L218H	probably benign	Het
Gm3633	A	C	14: 42,639,204	N42K	possibly damaging	Het
Gm4781	C	A	10: 100,396,989		noncoding transcript	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Gpr139	A	G	7: 119,144,942	V140A	probably benign	Het
Ighv1-62-3	G	T	12: 115,461,394	T13K	probably benign	Het
Itgb2l	T	C	16: 96,425,005	T629A	possibly damaging	Het
Kcnb2	T	C	1: 15,709,500	S199P	probably damaging	Het
Kdm1b	G	A	13: 47,077,486	G663D	probably damaging	Het
Lama1	A	G	17: 67,745,893	D407G	possibly damaging	Het
Macf1	T	C	4: 123,511,220	K391R	probably damaging	Het
Magi3	A	T	3: 104,105,791	S127T	probably damaging	Het
Map2	A	T	1: 66,438,796	D1759V	probably damaging	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Myrfl	T	C	10: 116,822,711	D447G	probably damaging	Het
Ndufb7	A	G	8: 83,571,465		probably benign	Het
Nt5e	T	A	9: 88,363,581	N301K	probably benign	Het
Olfr944	T	A	9: 39,218,114	Y252*	probably null	Het
Olfr960	A	T	9: 39,623,560	T146S	possibly damaging	Het
Pcdh10	A	G	3: 45,381,861	N870S	probably damaging	Het
Pcdh18	A	G	3: 49,754,856	V670A	probably benign	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Ric3	G	C	7: 109,038,723	S274R	probably benign	Het
Rimbp3	A	G	16: 17,213,331	T1540A	probably damaging	Het
Rnf165	A	G	18: 77,462,912	S107P	probably damaging	Het
Rp1l1	A	T	14: 64,031,356	M1464L	probably benign	Het
Slc41a3	A	G	6: 90,626,417	Y140C	probably damaging	Het
Ssb	A	T	2: 69,866,237	E38D	possibly damaging	Het
Syt14	A	T	1: 193,026,984	I16N	probably damaging	Het
Tet3	T	C	6: 83,375,896	T973A	probably damaging	Het
Tial1	T	C	7: 128,443,968		probably benign	Het
Tnfrsf1a	A	G	6: 125,360,712	T89A	possibly damaging	Het
Trpv5	T	C	6: 41,675,945	Y98C	possibly damaging	Het
Ylpm1	T	A	12: 85,015,493	S265T	probably damaging	Het
Ylpm1	A	G	12: 85,042,239	D1006G	probably damaging	Het

Other mutations in Btaf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Btaf1	APN	19	37009702	missense	probably damaging	1.00
IGL00535:Btaf1	APN	19	36997535	missense	probably damaging	1.00
IGL00574:Btaf1	APN	19	36969930	missense	probably benign	0.00
IGL00969:Btaf1	APN	19	37011252	splice site	probably benign
IGL01325:Btaf1	APN	19	37004649	splice site	probably benign
IGL01399:Btaf1	APN	19	37000170	nonsense	probably null
IGL02024:Btaf1	APN	19	36992426	splice site	probably benign
IGL02471:Btaf1	APN	19	37000192	missense	probably damaging	0.96
IGL02664:Btaf1	APN	19	36978428	splice site	probably benign
IGL02898:Btaf1	APN	19	36969068	missense	probably benign
IGL02995:Btaf1	APN	19	36981135	splice site	probably benign
IGL03023:Btaf1	APN	19	37010015	missense	possibly damaging	0.85
IGL03188:Btaf1	APN	19	36949108	missense	possibly damaging	0.91
IGL03353:Btaf1	APN	19	36992500	missense	probably damaging	1.00
freudenberg	UTSW	19	36988173	critical splice donor site	probably null
Galanos	UTSW	19	36949102	missense	probably damaging	1.00
3-1:Btaf1	UTSW	19	37010078	missense	probably damaging	1.00
R0013:Btaf1	UTSW	19	36958373	missense	probably benign
R0048:Btaf1	UTSW	19	37003524	missense	probably benign	0.01
R0117:Btaf1	UTSW	19	36969968	missense	probably benign	0.06
R0207:Btaf1	UTSW	19	37009648	nonsense	probably null
R0310:Btaf1	UTSW	19	37004534	missense	probably damaging	0.96
R0377:Btaf1	UTSW	19	36989002	missense	probably benign
R0419:Btaf1	UTSW	19	36945229	missense	probably damaging	0.99
R0440:Btaf1	UTSW	19	36986653	missense	probably damaging	0.99
R0532:Btaf1	UTSW	19	36951186	splice site	probably benign
R0612:Btaf1	UTSW	19	36969137	missense	probably damaging	0.99
R0731:Btaf1	UTSW	19	36997495	splice site	probably null
R0780:Btaf1	UTSW	19	36988922	missense	probably damaging	0.99
R0919:Btaf1	UTSW	19	36990743	missense	probably benign	0.03
R1104:Btaf1	UTSW	19	37004602	missense	probably damaging	1.00
R1263:Btaf1	UTSW	19	36956524	missense	probably benign	0.10
R1325:Btaf1	UTSW	19	36969162	missense	possibly damaging	0.68
R1447:Btaf1	UTSW	19	36992454	missense	probably benign	0.00
R1554:Btaf1	UTSW	19	36996598	missense	probably benign	0.02
R1649:Btaf1	UTSW	19	36981722	missense	probably benign
R1715:Btaf1	UTSW	19	36969121	missense	probably damaging	0.99
R1733:Btaf1	UTSW	19	36994962	missense	probably benign
R1764:Btaf1	UTSW	19	36951118	missense	probably benign	0.12
R1874:Btaf1	UTSW	19	36980583	missense	probably benign
R1911:Btaf1	UTSW	19	36986630	missense	probably benign
R1933:Btaf1	UTSW	19	36972957	missense	probably damaging	1.00
R2080:Btaf1	UTSW	19	36951148	missense	probably benign	0.09
R2483:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R2510:Btaf1	UTSW	19	37002445	missense	probably benign	0.08
R3623:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R3624:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R3801:Btaf1	UTSW	19	36986548	missense	probably benign
R3801:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R3802:Btaf1	UTSW	19	36986548	missense	probably benign
R3802:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R3803:Btaf1	UTSW	19	36986548	missense	probably benign
R3803:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R4077:Btaf1	UTSW	19	36986479	missense	probably benign	0.00
R4079:Btaf1	UTSW	19	36986479	missense	probably benign	0.00
R4133:Btaf1	UTSW	19	36961738	missense	probably benign	0.00
R4673:Btaf1	UTSW	19	36978372	missense	probably benign	0.00
R4731:Btaf1	UTSW	19	36981078	missense	probably benign	0.03
R4796:Btaf1	UTSW	19	36956428	missense	possibly damaging	0.95
R4824:Btaf1	UTSW	19	36981048	missense	possibly damaging	0.84
R4835:Btaf1	UTSW	19	37002458	missense	probably benign	0.00
R4837:Btaf1	UTSW	19	36966785	missense	probably benign
R4925:Btaf1	UTSW	19	37011333	missense	probably benign
R4968:Btaf1	UTSW	19	36969951	missense	probably null	0.71
R4976:Btaf1	UTSW	19	36986579	missense	probably benign
R5001:Btaf1	UTSW	19	36986652	missense	possibly damaging	0.90
R5037:Btaf1	UTSW	19	37003531	missense	probably damaging	1.00
R5211:Btaf1	UTSW	19	36996562	missense	probably benign	0.32
R5422:Btaf1	UTSW	19	36951107	missense	probably benign	0.09
R5429:Btaf1	UTSW	19	36994857	missense	possibly damaging	0.58
R5530:Btaf1	UTSW	19	36990775	missense	possibly damaging	0.85
R5582:Btaf1	UTSW	19	36988173	critical splice donor site	probably null
R5654:Btaf1	UTSW	19	36983615	missense	probably benign	0.35
R5744:Btaf1	UTSW	19	37004490	missense	probably benign	0.02
R6082:Btaf1	UTSW	19	36983542	missense	probably damaging	1.00
R6243:Btaf1	UTSW	19	36981120	missense	probably benign	0.02
R6291:Btaf1	UTSW	19	36973008	missense	probably benign	0.00
R6502:Btaf1	UTSW	19	36983617	missense	probably benign
R7034:Btaf1	UTSW	19	37004469	missense	probably benign
R7036:Btaf1	UTSW	19	37004469	missense	probably benign
R7085:Btaf1	UTSW	19	36972918	missense	probably benign
R7097:Btaf1	UTSW	19	36949102	missense	probably damaging	1.00
R7248:Btaf1	UTSW	19	36945314	missense	possibly damaging	0.54
R7386:Btaf1	UTSW	19	36958382	missense	probably benign	0.02
R7402:Btaf1	UTSW	19	37003515	missense	probably damaging	1.00
R7452:Btaf1	UTSW	19	36969127	missense	probably damaging	1.00
R7493:Btaf1	UTSW	19	37009605	missense	probably damaging	1.00
R7513:Btaf1	UTSW	19	36978403	missense	probably benign	0.30
R7888:Btaf1	UTSW	19	36965636	missense	probably benign	0.10
R7944:Btaf1	UTSW	19	36949165	missense	probably benign
R8062:Btaf1	UTSW	19	36992465	missense	probably benign	0.00
W0251:Btaf1	UTSW	19	37003504	missense	probably damaging	1.00
X0027:Btaf1	UTSW	19	36949096	nonsense	probably null
Z1088:Btaf1	UTSW	19	36986618	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAGACTGGCCTTCACTGTTG -3'
(R):5'- AAGGATACAGGCAAGTGCTTC -3'

Sequencing Primer
(F):5'- GCCTTGATGTACTATGCAATGGAC -3'
(R):5'- ACAGGCAAGTGCTTCAATTG -3'

Posted On

2016-06-21