Incidental Mutation 'R5039:Cyp2c55'
ID395734
Institutional Source Beutler Lab
Gene Symbol Cyp2c55
Ensembl Gene ENSMUSG00000025002
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 55
Synonyms2010318C06Rik
MMRRC Submission 042629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5039 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location39007019-39042693 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39038143 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 398 (D398G)
Ref Sequence ENSEMBL: ENSMUSP00000025966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025966]
Predicted Effect probably benign
Transcript: ENSMUST00000025966
AA Change: D398G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000025966
Gene: ENSMUSG00000025002
AA Change: D398G

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:p450 30 487 1.1e-154 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum but its specific substrate has not yet been determined. The gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. An additional gene, CYP2C17, was once thought to exist; however, CYP2C17 is now considered an artefact based on a chimera of CYP2C18 and CYP2C19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A C 17: 33,067,760 C23G probably damaging Het
Abcg4 G A 9: 44,281,566 A161V probably damaging Het
Anapc2 T C 2: 25,274,796 I64T possibly damaging Het
Arfgef1 T C 1: 10,199,736 D396G probably benign Het
Axl C T 7: 25,785,915 V163M probably damaging Het
Blm G A 7: 80,505,873 P353S possibly damaging Het
Btaf1 T C 19: 36,990,762 Y1116H probably benign Het
Ccdc18 T A 5: 108,158,648 probably null Het
Ccdc87 T C 19: 4,840,401 probably null Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ctr9 C A 7: 111,042,857 H297Q probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dnmt3l T C 10: 78,052,900 probably null Het
Dock4 C A 12: 40,817,746 N1440K probably damaging Het
Etnk1 T A 6: 143,195,317 probably null Het
Fam120a A T 13: 48,910,250 probably null Het
Fanca T C 8: 123,284,046 D908G probably benign Het
Gm17535 T A 9: 3,035,786 L218H probably benign Het
Gm3633 A C 14: 42,639,204 N42K possibly damaging Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Gpr139 A G 7: 119,144,942 V140A probably benign Het
Ighv1-62-3 G T 12: 115,461,394 T13K probably benign Het
Itgb2l T C 16: 96,425,005 T629A possibly damaging Het
Kcnb2 T C 1: 15,709,500 S199P probably damaging Het
Kdm1b G A 13: 47,077,486 G663D probably damaging Het
Lama1 A G 17: 67,745,893 D407G possibly damaging Het
Macf1 T C 4: 123,511,220 K391R probably damaging Het
Magi3 A T 3: 104,105,791 S127T probably damaging Het
Map2 A T 1: 66,438,796 D1759V probably damaging Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Myrfl T C 10: 116,822,711 D447G probably damaging Het
Ndufb7 A G 8: 83,571,465 probably benign Het
Nt5e T A 9: 88,363,581 N301K probably benign Het
Olfr944 T A 9: 39,218,114 Y252* probably null Het
Olfr960 A T 9: 39,623,560 T146S possibly damaging Het
Pcdh10 A G 3: 45,381,861 N870S probably damaging Het
Pcdh18 A G 3: 49,754,856 V670A probably benign Het
Polr1c G T 17: 46,247,709 probably benign Het
Ric3 G C 7: 109,038,723 S274R probably benign Het
Rimbp3 A G 16: 17,213,331 T1540A probably damaging Het
Rnf165 A G 18: 77,462,912 S107P probably damaging Het
Rp1l1 A T 14: 64,031,356 M1464L probably benign Het
Slc41a3 A G 6: 90,626,417 Y140C probably damaging Het
Ssb A T 2: 69,866,237 E38D possibly damaging Het
Syt14 A T 1: 193,026,984 I16N probably damaging Het
Tet3 T C 6: 83,375,896 T973A probably damaging Het
Tial1 T C 7: 128,443,968 probably benign Het
Tnfrsf1a A G 6: 125,360,712 T89A possibly damaging Het
Trpv5 T C 6: 41,675,945 Y98C possibly damaging Het
Ylpm1 T A 12: 85,015,493 S265T probably damaging Het
Ylpm1 A G 12: 85,042,239 D1006G probably damaging Het
Other mutations in Cyp2c55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Cyp2c55 APN 19 39011746 missense probably benign 0.41
IGL00537:Cyp2c55 APN 19 39011706 missense possibly damaging 0.93
IGL00959:Cyp2c55 APN 19 39038143 missense probably benign 0.00
IGL01140:Cyp2c55 APN 19 39018649 missense probably benign
IGL01792:Cyp2c55 APN 19 39042187 missense probably benign
PIT4453001:Cyp2c55 UTSW 19 39011791 missense probably damaging 1.00
R0472:Cyp2c55 UTSW 19 39031379 missense probably benign 0.01
R1452:Cyp2c55 UTSW 19 39011090 missense probably damaging 1.00
R1468:Cyp2c55 UTSW 19 39011081 missense probably damaging 0.96
R1468:Cyp2c55 UTSW 19 39011081 missense probably damaging 0.96
R1925:Cyp2c55 UTSW 19 39034377 missense probably benign 0.06
R2154:Cyp2c55 UTSW 19 39034375 missense probably damaging 1.00
R3814:Cyp2c55 UTSW 19 39007065 missense probably damaging 1.00
R4021:Cyp2c55 UTSW 19 39035434 splice site probably null
R4022:Cyp2c55 UTSW 19 39035434 splice site probably null
R4293:Cyp2c55 UTSW 19 39011791 missense probably damaging 1.00
R4294:Cyp2c55 UTSW 19 39011791 missense probably damaging 1.00
R4604:Cyp2c55 UTSW 19 39031386 missense possibly damaging 0.82
R4740:Cyp2c55 UTSW 19 39018729 missense probably benign
R4756:Cyp2c55 UTSW 19 39031371 missense probably damaging 1.00
R4879:Cyp2c55 UTSW 19 39042078 frame shift probably null
R5672:Cyp2c55 UTSW 19 39035546 missense probably benign 0.02
R5834:Cyp2c55 UTSW 19 39042067 missense probably benign 0.00
R6198:Cyp2c55 UTSW 19 39007121 nonsense probably null
R6255:Cyp2c55 UTSW 19 39018667 missense probably benign 0.25
R6431:Cyp2c55 UTSW 19 39031409 missense probably damaging 0.99
R6565:Cyp2c55 UTSW 19 39042122 missense probably benign 0.09
R7934:Cyp2c55 UTSW 19 39042091 missense probably damaging 1.00
R8477:Cyp2c55 UTSW 19 39011041 missense probably damaging 0.97
X0062:Cyp2c55 UTSW 19 39018689 missense probably damaging 0.98
Z1176:Cyp2c55 UTSW 19 39035513 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AATTGGTACTTGCCCATGGG -3'
(R):5'- CCTCAGAGTTGTATCTTGTGGAC -3'

Sequencing Primer
(F):5'- CCATGGGATGGGTCTCAAG -3'
(R):5'- ATATTGAGTTCAGGGTCAGCCTAGAC -3'
Posted On2016-06-21