Incidental Mutation 'R5076:Tmem163'
ID395736
Institutional Source Beutler Lab
Gene Symbol Tmem163
Ensembl Gene ENSMUSG00000026347
Gene Nametransmembrane protein 163
SynonymsSV31, 2610024A01Rik
MMRRC Submission 042665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5076 (G1)
Quality Score159
Status Validated
Chromosome1
Chromosomal Location127486546-127679548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127500276 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 191 (V191D)
Ref Sequence ENSEMBL: ENSMUSP00000140828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027585] [ENSMUST00000160616] [ENSMUST00000185560]
Predicted Effect probably damaging
Transcript: ENSMUST00000027585
AA Change: V191D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027585
Gene: ENSMUSG00000026347
AA Change: V191D

DomainStartEndE-ValueType
low complexity region 6 42 N/A INTRINSIC
transmembrane domain 89 111 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
transmembrane domain 223 242 N/A INTRINSIC
transmembrane domain 246 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160111
Predicted Effect probably damaging
Transcript: ENSMUST00000160616
AA Change: V191D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124307
Gene: ENSMUSG00000026347
AA Change: V191D

DomainStartEndE-ValueType
low complexity region 6 42 N/A INTRINSIC
transmembrane domain 89 111 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
transmembrane domain 223 242 N/A INTRINSIC
transmembrane domain 246 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162406
Predicted Effect probably damaging
Transcript: ENSMUST00000185560
AA Change: V191D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140828
Gene: ENSMUSG00000026347
AA Change: V191D

DomainStartEndE-ValueType
low complexity region 6 42 N/A INTRINSIC
transmembrane domain 89 111 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
transmembrane domain 223 242 N/A INTRINSIC
transmembrane domain 246 268 N/A INTRINSIC
Meta Mutation Damage Score 0.6714 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
MGI Phenotype PHENOTYPE: This transgene is useful in conjunction during breeding with mice carrying floxed alleles to produce germline excision of specific loxP-flanked sequences. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,056,252 I72V probably benign Het
Aadacl3 G A 4: 144,456,070 P276L possibly damaging Het
Acp6 T A 3: 97,167,989 S180T probably benign Het
Adgrd1 A T 5: 129,143,989 R449* probably null Het
Ak1 T C 2: 32,633,448 V176A probably damaging Het
Capzb A T 4: 139,287,814 D226V possibly damaging Het
Cd34 A T 1: 194,948,030 probably benign Het
Cdh15 C A 8: 122,864,348 D445E possibly damaging Het
Chil4 A G 3: 106,202,597 F367L probably damaging Het
Clstn2 T C 9: 97,483,079 Y458C probably damaging Het
Ctsw T C 19: 5,468,458 Y9C probably benign Het
Dhrs7 T C 12: 72,659,481 D50G probably benign Het
Dnah14 A G 1: 181,757,234 K3177E probably benign Het
Ehd1 T C 19: 6,277,221 F83L probably benign Het
Eif5a2 G A 3: 28,782,737 V59I possibly damaging Het
Emilin3 T A 2: 160,909,318 probably null Het
Entpd8 A G 2: 25,085,054 S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 G493D probably damaging Het
Fam208b C T 13: 3,576,357 V1198I probably benign Het
Gm11596 C T 11: 99,792,872 G141R unknown Het
Gm1840 T G 8: 5,640,130 noncoding transcript Het
H2-Q4 T C 17: 35,380,441 Y167H probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Itpr1 A G 6: 108,405,529 probably null Het
Kif2c A T 4: 117,174,869 probably benign Het
Klrb1-ps1 C T 6: 129,119,788 noncoding transcript Het
Krtap9-5 A T 11: 99,949,468 T332S unknown Het
Lrrc39 A T 3: 116,579,540 E283V probably benign Het
Mdga1 A G 17: 29,850,554 S447P possibly damaging Het
Mindy1 G A 3: 95,295,399 V425M probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Muc3a T A 5: 137,210,540 T159S probably damaging Het
Olfr1252 T A 2: 89,721,401 T237S probably damaging Het
Olfr1310 A T 2: 112,008,592 M198K probably damaging Het
Olfr286 T A 15: 98,226,761 I295F probably damaging Het
Pcdhga4 G A 18: 37,685,595 V66I probably benign Het
Pdhx T C 2: 103,041,077 T203A probably damaging Het
Pdss1 A G 2: 22,899,917 probably null Het
Pdxk G T 10: 78,450,307 Q103K probably benign Het
Peg3 A G 7: 6,708,420 C1268R probably damaging Het
Pitpnc1 A T 11: 107,296,267 S77T probably damaging Het
Pnisr T A 4: 21,874,990 probably benign Het
Poc1b C T 10: 99,107,841 T22I probably damaging Het
Ppfia1 G A 7: 144,506,264 R604W probably damaging Het
Ppp1r3a A G 6: 14,754,681 F189S probably damaging Het
Rbks T A 5: 31,650,451 Y99* probably null Het
Rsg1 A G 4: 141,217,385 I82M probably benign Het
Sh3rf2 G T 18: 42,053,924 C36F probably damaging Het
Spock3 T A 8: 63,345,855 N303K probably damaging Het
Tcaf2 T C 6: 42,629,467 T518A probably benign Het
Trappc6b A G 12: 59,050,308 V76A probably damaging Het
Ube2nl A G 7: 61,549,532 noncoding transcript Het
Unc5d C T 8: 28,694,676 V599M possibly damaging Het
Vmn1r184 A T 7: 26,266,921 M31L probably benign Het
Vrtn C A 12: 84,649,474 Q333K probably damaging Het
Zfp788 T A 7: 41,648,584 F163I possibly damaging Het
Zfyve1 C T 12: 83,555,647 R458H probably damaging Het
Other mutations in Tmem163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01747:Tmem163 APN 1 127668720 missense probably damaging 1.00
IGL02850:Tmem163 APN 1 127500247 missense probably benign 0.00
R0201:Tmem163 UTSW 1 127668637 splice site probably benign
R1723:Tmem163 UTSW 1 127551371 missense probably damaging 1.00
R1834:Tmem163 UTSW 1 127677509 missense probably benign 0.03
R1836:Tmem163 UTSW 1 127677509 missense probably benign 0.03
R2289:Tmem163 UTSW 1 127495740 missense possibly damaging 0.61
R4907:Tmem163 UTSW 1 127519370 missense probably damaging 1.00
R4912:Tmem163 UTSW 1 127491625 missense probably damaging 1.00
R5240:Tmem163 UTSW 1 127491552 utr 3 prime probably benign
R5270:Tmem163 UTSW 1 127491552 utr 3 prime probably benign
R5271:Tmem163 UTSW 1 127491552 utr 3 prime probably benign
R5366:Tmem163 UTSW 1 127500305 splice site probably benign
R5617:Tmem163 UTSW 1 127551330 missense possibly damaging 0.89
R5928:Tmem163 UTSW 1 127491646 missense probably damaging 0.99
R6115:Tmem163 UTSW 1 127677448 missense possibly damaging 0.63
R6146:Tmem163 UTSW 1 127519389 missense probably benign 0.01
R6316:Tmem163 UTSW 1 127551365 missense probably benign 0.01
R6472:Tmem163 UTSW 1 127495734 missense probably benign 0.09
R6604:Tmem163 UTSW 1 127491610 missense possibly damaging 0.61
R6765:Tmem163 UTSW 1 127551341 missense probably damaging 1.00
R6848:Tmem163 UTSW 1 127551380 missense probably damaging 1.00
R7387:Tmem163 UTSW 1 127519443 critical splice acceptor site probably null
R7737:Tmem163 UTSW 1 127491610 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TCATCTGCAAGACCTCAGCATC -3'
(R):5'- TTAGTCTGGCTGCTTTTAATCATCG -3'

Sequencing Primer
(F):5'- TCTAACAGCATCCAGGCAGG -3'
(R):5'- GGCTGCTTTTAATCATCGTCTCAAC -3'
Posted On2016-06-21