Incidental Mutation 'R5076:Pdss1'
ID 395739
Institutional Source Beutler Lab
Gene Symbol Pdss1
Ensembl Gene ENSMUSG00000026784
Gene Name prenyl (solanesyl) diphosphate synthase, subunit 1
Synonyms 2610203G20Rik, Tprt, mSPS1, 2700031G06Rik
MMRRC Submission 042665-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5076 (G1)
Quality Score 173
Status Validated
Chromosome 2
Chromosomal Location 22895522-22940266 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to G at 22899917 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053729] [ENSMUST00000135621] [ENSMUST00000141215] [ENSMUST00000141215] [ENSMUST00000152170]
AlphaFold Q33DR2
Predicted Effect probably benign
Transcript: ENSMUST00000053729
SMART Domains Protein: ENSMUSP00000055689
Gene: ENSMUSG00000026784

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:polyprenyl_synt 117 366 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000091396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122676
Predicted Effect probably benign
Transcript: ENSMUST00000135621
Predicted Effect probably null
Transcript: ENSMUST00000141215
Predicted Effect probably null
Transcript: ENSMUST00000141215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148072
Predicted Effect probably benign
Transcript: ENSMUST00000152170
SMART Domains Protein: ENSMUSP00000121873
Gene: ENSMUSG00000026784

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:polyprenyl_synt 114 276 6e-35 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that elongates the prenyl side-chain of coenzyme Q, or ubiquinone, one of the key elements in the respiratory chain. The gene product catalyzes the formation of all trans-polyprenyl pyrophosphates from isopentyl diphosphate in the assembly of polyisoprenoid side chains, the first step in coenzyme Q biosynthesis. The protein may be peripherally associated with the inner mitochondrial membrane, though no transit peptide has been definitively identified to date. Defects in this gene are a cause of coenzyme Q10 deficiency. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,056,252 I72V probably benign Het
Aadacl3 G A 4: 144,456,070 P276L possibly damaging Het
Acp6 T A 3: 97,167,989 S180T probably benign Het
Adgrd1 A T 5: 129,143,989 R449* probably null Het
Ak1 T C 2: 32,633,448 V176A probably damaging Het
Capzb A T 4: 139,287,814 D226V possibly damaging Het
Cd34 A T 1: 194,948,030 probably benign Het
Cdh15 C A 8: 122,864,348 D445E possibly damaging Het
Chil4 A G 3: 106,202,597 F367L probably damaging Het
Clstn2 T C 9: 97,483,079 Y458C probably damaging Het
Ctsw T C 19: 5,468,458 Y9C probably benign Het
Dhrs7 T C 12: 72,659,481 D50G probably benign Het
Dnah14 A G 1: 181,757,234 K3177E probably benign Het
Ehd1 T C 19: 6,277,221 F83L probably benign Het
Eif5a2 G A 3: 28,782,737 V59I possibly damaging Het
Emilin3 T A 2: 160,909,318 probably null Het
Entpd8 A G 2: 25,085,054 S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 G493D probably damaging Het
Fam208b C T 13: 3,576,357 V1198I probably benign Het
Gm11596 C T 11: 99,792,872 G141R unknown Het
Gm1840 T G 8: 5,640,130 noncoding transcript Het
H2-Q4 T C 17: 35,380,441 Y167H probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Itpr1 A G 6: 108,405,529 probably null Het
Kif2c A T 4: 117,174,869 probably benign Het
Klrb1-ps1 C T 6: 129,119,788 noncoding transcript Het
Krtap9-5 A T 11: 99,949,468 T332S unknown Het
Lrrc39 A T 3: 116,579,540 E283V probably benign Het
Mdga1 A G 17: 29,850,554 S447P possibly damaging Het
Mindy1 G A 3: 95,295,399 V425M probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Muc3a T A 5: 137,210,540 T159S probably damaging Het
Olfr1252 T A 2: 89,721,401 T237S probably damaging Het
Olfr1310 A T 2: 112,008,592 M198K probably damaging Het
Olfr286 T A 15: 98,226,761 I295F probably damaging Het
Pcdhga4 G A 18: 37,685,595 V66I probably benign Het
Pdhx T C 2: 103,041,077 T203A probably damaging Het
Pdxk G T 10: 78,450,307 Q103K probably benign Het
Peg3 A G 7: 6,708,420 C1268R probably damaging Het
Pitpnc1 A T 11: 107,296,267 S77T probably damaging Het
Pnisr T A 4: 21,874,990 probably benign Het
Poc1b C T 10: 99,107,841 T22I probably damaging Het
Ppfia1 G A 7: 144,506,264 R604W probably damaging Het
Ppp1r3a A G 6: 14,754,681 F189S probably damaging Het
Rbks T A 5: 31,650,451 Y99* probably null Het
Rsg1 A G 4: 141,217,385 I82M probably benign Het
Sh3rf2 G T 18: 42,053,924 C36F probably damaging Het
Spock3 T A 8: 63,345,855 N303K probably damaging Het
Tcaf2 T C 6: 42,629,467 T518A probably benign Het
Tmem163 A T 1: 127,500,276 V191D probably damaging Het
Trappc6b A G 12: 59,050,308 V76A probably damaging Het
Ube2nl A G 7: 61,549,532 noncoding transcript Het
Unc5d C T 8: 28,694,676 V599M possibly damaging Het
Vmn1r184 A T 7: 26,266,921 M31L probably benign Het
Vrtn C A 12: 84,649,474 Q333K probably damaging Het
Zfp788 T A 7: 41,648,584 F163I possibly damaging Het
Zfyve1 C T 12: 83,555,647 R458H probably damaging Het
Other mutations in Pdss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Pdss1 APN 2 22935577 missense possibly damaging 0.49
IGL02512:Pdss1 APN 2 22912646 missense probably damaging 1.00
IGL02691:Pdss1 APN 2 22915241 missense probably benign
LCD18:Pdss1 UTSW 2 22900968 intron probably benign
R0190:Pdss1 UTSW 2 22906831 missense probably damaging 0.97
R0576:Pdss1 UTSW 2 22915413 critical splice acceptor site probably null
R0732:Pdss1 UTSW 2 22901312 missense probably benign 0.00
R1682:Pdss1 UTSW 2 22915519 missense probably damaging 1.00
R1808:Pdss1 UTSW 2 22906834 nonsense probably null
R2430:Pdss1 UTSW 2 22929593 nonsense probably null
R2937:Pdss1 UTSW 2 22906787 splice site probably null
R2938:Pdss1 UTSW 2 22906787 splice site probably null
R4181:Pdss1 UTSW 2 22915505 missense probably damaging 1.00
R4302:Pdss1 UTSW 2 22915505 missense probably damaging 1.00
R4323:Pdss1 UTSW 2 22912596 splice site probably benign
R5108:Pdss1 UTSW 2 22906883 missense possibly damaging 0.94
R6333:Pdss1 UTSW 2 22901766 missense probably damaging 1.00
R7138:Pdss1 UTSW 2 22912669 missense probably damaging 1.00
R7286:Pdss1 UTSW 2 22935641 critical splice donor site probably null
R8169:Pdss1 UTSW 2 22901812 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAAGCCCTTGCCAGACTAG -3'
(R):5'- TTCGAGAAGGGGATCTGGATGC -3'

Sequencing Primer
(F):5'- AGTTCCAAGGGGCTCTAACTC -3'
(R):5'- GGATCTGGATGCCAACAACTGC -3'
Posted On 2016-06-21