Incidental Mutation 'R5076:Entpd8'
ID 395740
Institutional Source Beutler Lab
Gene Symbol Entpd8
Ensembl Gene ENSMUSG00000036813
Gene Name ectonucleoside triphosphate diphosphohydrolase 8
Synonyms
MMRRC Submission 042665-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5076 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 25080304-25085716 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25085054 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 426 (S426G)
Ref Sequence ENSEMBL: ENSMUSP00000110017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044018] [ENSMUST00000044078] [ENSMUST00000114373] [ENSMUST00000114376] [ENSMUST00000114380] [ENSMUST00000150625]
AlphaFold Q8K0L2
Predicted Effect probably benign
Transcript: ENSMUST00000044018
SMART Domains Protein: ENSMUSP00000037423
Gene: ENSMUSG00000036805

DomainStartEndE-ValueType
TPR 38 71 8.17e-1 SMART
TPR 72 105 1.47e-2 SMART
TPR 122 155 1.97e1 SMART
low complexity region 166 180 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
PB1 285 365 6.76e-9 SMART
SH3 372 427 1.81e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000044078
AA Change: S466G

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040628
Gene: ENSMUSG00000036813
AA Change: S466G

DomainStartEndE-ValueType
Pfam:GDA1_CD39 34 463 1.8e-106 PFAM
transmembrane domain 472 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114373
SMART Domains Protein: ENSMUSP00000110014
Gene: ENSMUSG00000036805

DomainStartEndE-ValueType
TPR 38 71 8.17e-1 SMART
TPR 72 105 1.47e-2 SMART
TPR 122 155 1.97e1 SMART
low complexity region 166 180 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
PB1 277 357 6.76e-9 SMART
SH3 364 419 1.81e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114376
AA Change: S426G

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110017
Gene: ENSMUSG00000036813
AA Change: S426G

DomainStartEndE-ValueType
Pfam:GDA1_CD39 34 355 1.4e-77 PFAM
Pfam:GDA1_CD39 347 423 2.1e-11 PFAM
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114380
AA Change: S466G

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110022
Gene: ENSMUSG00000036813
AA Change: S466G

DomainStartEndE-ValueType
Pfam:GDA1_CD39 34 465 1.1e-100 PFAM
transmembrane domain 472 494 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149470
Predicted Effect probably benign
Transcript: ENSMUST00000150625
SMART Domains Protein: ENSMUSP00000142316
Gene: ENSMUSG00000036813

DomainStartEndE-ValueType
Pfam:GDA1_CD39 1 41 8.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152326
Meta Mutation Damage Score 0.3857 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,056,252 I72V probably benign Het
Aadacl3 G A 4: 144,456,070 P276L possibly damaging Het
Acp6 T A 3: 97,167,989 S180T probably benign Het
Adgrd1 A T 5: 129,143,989 R449* probably null Het
Ak1 T C 2: 32,633,448 V176A probably damaging Het
Capzb A T 4: 139,287,814 D226V possibly damaging Het
Cd34 A T 1: 194,948,030 probably benign Het
Cdh15 C A 8: 122,864,348 D445E possibly damaging Het
Chil4 A G 3: 106,202,597 F367L probably damaging Het
Clstn2 T C 9: 97,483,079 Y458C probably damaging Het
Ctsw T C 19: 5,468,458 Y9C probably benign Het
Dhrs7 T C 12: 72,659,481 D50G probably benign Het
Dnah14 A G 1: 181,757,234 K3177E probably benign Het
Ehd1 T C 19: 6,277,221 F83L probably benign Het
Eif5a2 G A 3: 28,782,737 V59I possibly damaging Het
Emilin3 T A 2: 160,909,318 probably null Het
Epb41l4b C T 4: 57,040,984 G493D probably damaging Het
Fam208b C T 13: 3,576,357 V1198I probably benign Het
Gm11596 C T 11: 99,792,872 G141R unknown Het
Gm1840 T G 8: 5,640,130 noncoding transcript Het
H2-Q4 T C 17: 35,380,441 Y167H probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Itpr1 A G 6: 108,405,529 probably null Het
Kif2c A T 4: 117,174,869 probably benign Het
Klrb1-ps1 C T 6: 129,119,788 noncoding transcript Het
Krtap9-5 A T 11: 99,949,468 T332S unknown Het
Lrrc39 A T 3: 116,579,540 E283V probably benign Het
Mdga1 A G 17: 29,850,554 S447P possibly damaging Het
Mindy1 G A 3: 95,295,399 V425M probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Muc3a T A 5: 137,210,540 T159S probably damaging Het
Olfr1252 T A 2: 89,721,401 T237S probably damaging Het
Olfr1310 A T 2: 112,008,592 M198K probably damaging Het
Olfr286 T A 15: 98,226,761 I295F probably damaging Het
Pcdhga4 G A 18: 37,685,595 V66I probably benign Het
Pdhx T C 2: 103,041,077 T203A probably damaging Het
Pdss1 A G 2: 22,899,917 probably null Het
Pdxk G T 10: 78,450,307 Q103K probably benign Het
Peg3 A G 7: 6,708,420 C1268R probably damaging Het
Pitpnc1 A T 11: 107,296,267 S77T probably damaging Het
Pnisr T A 4: 21,874,990 probably benign Het
Poc1b C T 10: 99,107,841 T22I probably damaging Het
Ppfia1 G A 7: 144,506,264 R604W probably damaging Het
Ppp1r3a A G 6: 14,754,681 F189S probably damaging Het
Rbks T A 5: 31,650,451 Y99* probably null Het
Rsg1 A G 4: 141,217,385 I82M probably benign Het
Sh3rf2 G T 18: 42,053,924 C36F probably damaging Het
Spock3 T A 8: 63,345,855 N303K probably damaging Het
Tcaf2 T C 6: 42,629,467 T518A probably benign Het
Tmem163 A T 1: 127,500,276 V191D probably damaging Het
Trappc6b A G 12: 59,050,308 V76A probably damaging Het
Ube2nl A G 7: 61,549,532 noncoding transcript Het
Unc5d C T 8: 28,694,676 V599M possibly damaging Het
Vmn1r184 A T 7: 26,266,921 M31L probably benign Het
Vrtn C A 12: 84,649,474 Q333K probably damaging Het
Zfp788 T A 7: 41,648,584 F163I possibly damaging Het
Zfyve1 C T 12: 83,555,647 R458H probably damaging Het
Other mutations in Entpd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Entpd8 APN 2 25084346 missense probably benign 0.01
IGL01679:Entpd8 APN 2 25084366 missense probably benign 0.01
IGL02540:Entpd8 APN 2 25084719 splice site probably null
IGL02803:Entpd8 APN 2 25085139 missense probably damaging 1.00
IGL02876:Entpd8 APN 2 25085060 missense probably benign 0.32
R0531:Entpd8 UTSW 2 25084769 missense probably damaging 1.00
R1579:Entpd8 UTSW 2 25084974 missense possibly damaging 0.94
R1680:Entpd8 UTSW 2 25084024 missense probably damaging 1.00
R1780:Entpd8 UTSW 2 25084306 missense probably benign 0.15
R2228:Entpd8 UTSW 2 25085016 missense probably damaging 0.99
R4979:Entpd8 UTSW 2 25082955 missense possibly damaging 0.90
R5276:Entpd8 UTSW 2 25085045 missense probably benign 0.01
R5695:Entpd8 UTSW 2 25084334 missense probably benign 0.16
R6994:Entpd8 UTSW 2 25083309 missense probably damaging 0.98
R7850:Entpd8 UTSW 2 25085016 missense probably damaging 0.99
R7977:Entpd8 UTSW 2 25084766 missense probably damaging 0.99
R7987:Entpd8 UTSW 2 25084766 missense probably damaging 0.99
R8544:Entpd8 UTSW 2 25083844 missense probably benign 0.03
R8683:Entpd8 UTSW 2 25084980 missense probably damaging 1.00
R8778:Entpd8 UTSW 2 25081846 missense probably benign 0.16
R9022:Entpd8 UTSW 2 25085132 missense probably benign
R9182:Entpd8 UTSW 2 25081919 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGTTCCAGAAGCAGGTGAC -3'
(R):5'- GGTTGACAACACAAACAGCTG -3'

Sequencing Primer
(F):5'- CCCTAAGAATCTAGGCATGTCTGG -3'
(R):5'- CACAAACAGCTGTGTTGTCACTG -3'
Posted On 2016-06-21