Incidental Mutation 'R5076:Ak1'
ID395741
Institutional Source Beutler Lab
Gene Symbol Ak1
Ensembl Gene ENSMUSG00000026817
Gene Nameadenylate kinase 1
SynonymsAk-1, B430205N08Rik
MMRRC Submission 042665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R5076 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32621758-32635058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32633448 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 176 (V176A)
Ref Sequence ENSEMBL: ENSMUSP00000068479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068271] [ENSMUST00000113277] [ENSMUST00000113278] [ENSMUST00000156578] [ENSMUST00000195721]
Predicted Effect probably damaging
Transcript: ENSMUST00000068271
AA Change: V176A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068479
Gene: ENSMUSG00000026817
AA Change: V176A

DomainStartEndE-ValueType
Pfam:AAA_33 26 173 2.7e-10 PFAM
Pfam:AAA_17 26 194 5.4e-8 PFAM
Pfam:ADK 29 185 1.3e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113277
AA Change: V160A

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108902
Gene: ENSMUSG00000026817
AA Change: V160A

DomainStartEndE-ValueType
Pfam:AAA_33 10 159 2.7e-10 PFAM
Pfam:AAA_17 10 171 5.4e-11 PFAM
Pfam:AAA_18 11 149 7.6e-8 PFAM
Pfam:ADK 13 169 7.5e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113278
AA Change: V160A

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108903
Gene: ENSMUSG00000026817
AA Change: V160A

DomainStartEndE-ValueType
Pfam:AAA_33 10 159 2.7e-10 PFAM
Pfam:AAA_17 10 171 5.4e-11 PFAM
Pfam:AAA_18 11 149 7.6e-8 PFAM
Pfam:ADK 13 169 7.5e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135392
Predicted Effect probably benign
Transcript: ENSMUST00000156578
SMART Domains Protein: ENSMUSP00000123534
Gene: ENSMUSG00000026817

DomainStartEndE-ValueType
Pfam:AAA_17 10 86 1.5e-10 PFAM
Pfam:ADK 13 89 3.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195721
SMART Domains Protein: ENSMUSP00000142174
Gene: ENSMUSG00000026817

DomainStartEndE-ValueType
Pfam:ADK 13 96 2e-32 PFAM
Meta Mutation Damage Score 0.7125 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adenylate kinase enzyme involved in energy metabolism and homeostasis of cellular adenine nucleotide ratios in different intracellular compartments. This gene is highly expressed in skeletal muscle, brain and erythrocytes. Certain mutations in this gene resulting in a functionally inadequate enzyme are associated with a rare genetic disorder causing nonspherocytic hemolytic anemia. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased adenosine triphosphate (ATP) turnover and reduced efficiency of ATP utilization during muscle contraction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,056,252 I72V probably benign Het
Aadacl3 G A 4: 144,456,070 P276L possibly damaging Het
Acp6 T A 3: 97,167,989 S180T probably benign Het
Adgrd1 A T 5: 129,143,989 R449* probably null Het
Capzb A T 4: 139,287,814 D226V possibly damaging Het
Cd34 A T 1: 194,948,030 probably benign Het
Cdh15 C A 8: 122,864,348 D445E possibly damaging Het
Chil4 A G 3: 106,202,597 F367L probably damaging Het
Clstn2 T C 9: 97,483,079 Y458C probably damaging Het
Ctsw T C 19: 5,468,458 Y9C probably benign Het
Dhrs7 T C 12: 72,659,481 D50G probably benign Het
Dnah14 A G 1: 181,757,234 K3177E probably benign Het
Ehd1 T C 19: 6,277,221 F83L probably benign Het
Eif5a2 G A 3: 28,782,737 V59I possibly damaging Het
Emilin3 T A 2: 160,909,318 probably null Het
Entpd8 A G 2: 25,085,054 S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 G493D probably damaging Het
Fam208b C T 13: 3,576,357 V1198I probably benign Het
Gm11596 C T 11: 99,792,872 G141R unknown Het
Gm1840 T G 8: 5,640,130 noncoding transcript Het
H2-Q4 T C 17: 35,380,441 Y167H probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Itpr1 A G 6: 108,405,529 probably null Het
Kif2c A T 4: 117,174,869 probably benign Het
Klrb1-ps1 C T 6: 129,119,788 noncoding transcript Het
Krtap9-5 A T 11: 99,949,468 T332S unknown Het
Lrrc39 A T 3: 116,579,540 E283V probably benign Het
Mdga1 A G 17: 29,850,554 S447P possibly damaging Het
Mindy1 G A 3: 95,295,399 V425M probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Muc3a T A 5: 137,210,540 T159S probably damaging Het
Olfr1252 T A 2: 89,721,401 T237S probably damaging Het
Olfr1310 A T 2: 112,008,592 M198K probably damaging Het
Olfr286 T A 15: 98,226,761 I295F probably damaging Het
Pcdhga4 G A 18: 37,685,595 V66I probably benign Het
Pdhx T C 2: 103,041,077 T203A probably damaging Het
Pdss1 A G 2: 22,899,917 probably null Het
Pdxk G T 10: 78,450,307 Q103K probably benign Het
Peg3 A G 7: 6,708,420 C1268R probably damaging Het
Pitpnc1 A T 11: 107,296,267 S77T probably damaging Het
Pnisr T A 4: 21,874,990 probably benign Het
Poc1b C T 10: 99,107,841 T22I probably damaging Het
Ppfia1 G A 7: 144,506,264 R604W probably damaging Het
Ppp1r3a A G 6: 14,754,681 F189S probably damaging Het
Rbks T A 5: 31,650,451 Y99* probably null Het
Rsg1 A G 4: 141,217,385 I82M probably benign Het
Sh3rf2 G T 18: 42,053,924 C36F probably damaging Het
Spock3 T A 8: 63,345,855 N303K probably damaging Het
Tcaf2 T C 6: 42,629,467 T518A probably benign Het
Tmem163 A T 1: 127,500,276 V191D probably damaging Het
Trappc6b A G 12: 59,050,308 V76A probably damaging Het
Ube2nl A G 7: 61,549,532 noncoding transcript Het
Unc5d C T 8: 28,694,676 V599M possibly damaging Het
Vmn1r184 A T 7: 26,266,921 M31L probably benign Het
Vrtn C A 12: 84,649,474 Q333K probably damaging Het
Zfp788 T A 7: 41,648,584 F163I possibly damaging Het
Zfyve1 C T 12: 83,555,647 R458H probably damaging Het
Other mutations in Ak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Ak1 APN 2 32633495 unclassified probably benign
R1472:Ak1 UTSW 2 32630301 missense probably damaging 1.00
R1476:Ak1 UTSW 2 32633466 missense probably benign
R1876:Ak1 UTSW 2 32630270 missense probably damaging 0.99
R2004:Ak1 UTSW 2 32629610 missense probably benign
R4067:Ak1 UTSW 2 32629581 missense probably benign 0.05
R4246:Ak1 UTSW 2 32633372 missense possibly damaging 0.54
R4873:Ak1 UTSW 2 32631177 missense probably benign 0.28
R4875:Ak1 UTSW 2 32631177 missense probably benign 0.28
R6187:Ak1 UTSW 2 32633477 missense probably damaging 0.99
R6458:Ak1 UTSW 2 32630373 missense probably damaging 1.00
R6818:Ak1 UTSW 2 32630373 missense probably damaging 1.00
R6917:Ak1 UTSW 2 32631152 missense possibly damaging 0.86
R6919:Ak1 UTSW 2 32631122 missense possibly damaging 0.62
R8238:Ak1 UTSW 2 32633669 missense probably damaging 1.00
R8803:Ak1 UTSW 2 32633478 missense probably benign 0.28
Z1088:Ak1 UTSW 2 32630271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCCACCCTACGCAGATTG -3'
(R):5'- AGAGAAGACAGTGTCCACCG -3'

Sequencing Primer
(F):5'- TACGCAGATTGGACAGCC -3'
(R):5'- CCTTCGGCATTGACCTGTGG -3'
Posted On2016-06-21