Incidental Mutation 'R5076:Pdhx'
ID 395743
Institutional Source Beutler Lab
Gene Symbol Pdhx
Ensembl Gene ENSMUSG00000010914
Gene Name pyruvate dehydrogenase complex, component X
Synonyms Pdx1
MMRRC Submission 042665-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5076 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 103021075-103073513 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103041077 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 203 (T203A)
Ref Sequence ENSEMBL: ENSMUSP00000106814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011058] [ENSMUST00000111183] [ENSMUST00000132449]
AlphaFold Q8BKZ9
Predicted Effect possibly damaging
Transcript: ENSMUST00000011058
AA Change: T203A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000011058
Gene: ENSMUSG00000010914
AA Change: T203A

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:Biotin_lipoyl 57 131 1.3e-21 PFAM
low complexity region 148 172 N/A INTRINSIC
Pfam:E3_binding 182 217 5e-9 PFAM
low complexity region 233 249 N/A INTRINSIC
Pfam:2-oxoacid_dh 272 501 8.4e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111183
AA Change: T203A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106814
Gene: ENSMUSG00000010914
AA Change: T203A

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:Biotin_lipoyl 57 131 1.8e-21 PFAM
low complexity region 148 172 N/A INTRINSIC
Pfam:E3_binding 180 216 6.9e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000132449
AA Change: T138A

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119172
Gene: ENSMUSG00000010914
AA Change: T138A

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 5 66 1.3e-14 PFAM
low complexity region 83 107 N/A INTRINSIC
Pfam:E3_binding 115 153 6.1e-14 PFAM
low complexity region 168 184 N/A INTRINSIC
Meta Mutation Damage Score 0.3151 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pyruvate dehydrogenase (PDH) complex is located in the mitochondrial matrix and catalyzes the conversion of pyruvate to acetyl coenzyme A. The PDH complex thereby links glycolysis to Krebs cycle. The PDH complex contains three catalytic subunits, E1, E2, and E3, two regulatory subunits, E1 kinase and E1 phosphatase, and a non-catalytic subunit, E3 binding protein (E3BP). This gene encodes the E3 binding protein subunit; also known as component X of the pyruvate dehydrogenase complex. This protein tethers E3 dimers to the E2 core of the PDH complex. Defects in this gene are a cause of pyruvate dehydrogenase deficiency which results in neurological dysfunction and lactic acidosis in infancy and early childhood. This protein is also a minor antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC eventually leads to cirrhosis and liver failure. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,056,252 I72V probably benign Het
Aadacl3 G A 4: 144,456,070 P276L possibly damaging Het
Acp6 T A 3: 97,167,989 S180T probably benign Het
Adgrd1 A T 5: 129,143,989 R449* probably null Het
Ak1 T C 2: 32,633,448 V176A probably damaging Het
Capzb A T 4: 139,287,814 D226V possibly damaging Het
Cd34 A T 1: 194,948,030 probably benign Het
Cdh15 C A 8: 122,864,348 D445E possibly damaging Het
Chil4 A G 3: 106,202,597 F367L probably damaging Het
Clstn2 T C 9: 97,483,079 Y458C probably damaging Het
Ctsw T C 19: 5,468,458 Y9C probably benign Het
Dhrs7 T C 12: 72,659,481 D50G probably benign Het
Dnah14 A G 1: 181,757,234 K3177E probably benign Het
Ehd1 T C 19: 6,277,221 F83L probably benign Het
Eif5a2 G A 3: 28,782,737 V59I possibly damaging Het
Emilin3 T A 2: 160,909,318 probably null Het
Entpd8 A G 2: 25,085,054 S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 G493D probably damaging Het
Fam208b C T 13: 3,576,357 V1198I probably benign Het
Gm11596 C T 11: 99,792,872 G141R unknown Het
Gm1840 T G 8: 5,640,130 noncoding transcript Het
H2-Q4 T C 17: 35,380,441 Y167H probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Itpr1 A G 6: 108,405,529 probably null Het
Kif2c A T 4: 117,174,869 probably benign Het
Klrb1-ps1 C T 6: 129,119,788 noncoding transcript Het
Krtap9-5 A T 11: 99,949,468 T332S unknown Het
Lrrc39 A T 3: 116,579,540 E283V probably benign Het
Mdga1 A G 17: 29,850,554 S447P possibly damaging Het
Mindy1 G A 3: 95,295,399 V425M probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Muc3a T A 5: 137,210,540 T159S probably damaging Het
Olfr1252 T A 2: 89,721,401 T237S probably damaging Het
Olfr1310 A T 2: 112,008,592 M198K probably damaging Het
Olfr286 T A 15: 98,226,761 I295F probably damaging Het
Pcdhga4 G A 18: 37,685,595 V66I probably benign Het
Pdss1 A G 2: 22,899,917 probably null Het
Pdxk G T 10: 78,450,307 Q103K probably benign Het
Peg3 A G 7: 6,708,420 C1268R probably damaging Het
Pitpnc1 A T 11: 107,296,267 S77T probably damaging Het
Pnisr T A 4: 21,874,990 probably benign Het
Poc1b C T 10: 99,107,841 T22I probably damaging Het
Ppfia1 G A 7: 144,506,264 R604W probably damaging Het
Ppp1r3a A G 6: 14,754,681 F189S probably damaging Het
Rbks T A 5: 31,650,451 Y99* probably null Het
Rsg1 A G 4: 141,217,385 I82M probably benign Het
Sh3rf2 G T 18: 42,053,924 C36F probably damaging Het
Spock3 T A 8: 63,345,855 N303K probably damaging Het
Tcaf2 T C 6: 42,629,467 T518A probably benign Het
Tmem163 A T 1: 127,500,276 V191D probably damaging Het
Trappc6b A G 12: 59,050,308 V76A probably damaging Het
Ube2nl A G 7: 61,549,532 noncoding transcript Het
Unc5d C T 8: 28,694,676 V599M possibly damaging Het
Vmn1r184 A T 7: 26,266,921 M31L probably benign Het
Vrtn C A 12: 84,649,474 Q333K probably damaging Het
Zfp788 T A 7: 41,648,584 F163I possibly damaging Het
Zfyve1 C T 12: 83,555,647 R458H probably damaging Het
Other mutations in Pdhx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Pdhx APN 2 103030341 unclassified probably benign
IGL02450:Pdhx APN 2 103042249 missense probably benign 0.00
R0152:Pdhx UTSW 2 103028280 missense probably benign 0.04
R0317:Pdhx UTSW 2 103028280 missense probably benign 0.04
R2351:Pdhx UTSW 2 103024217 nonsense probably null
R3937:Pdhx UTSW 2 103022219 missense probably damaging 1.00
R3950:Pdhx UTSW 2 103035241 missense probably damaging 0.99
R4546:Pdhx UTSW 2 103073397 missense probably null 0.99
R4677:Pdhx UTSW 2 103073466 splice site probably null
R4744:Pdhx UTSW 2 103042296 missense probably benign 0.01
R4996:Pdhx UTSW 2 103030312 missense probably damaging 1.00
R5000:Pdhx UTSW 2 103041040 splice site probably null
R5682:Pdhx UTSW 2 103035340 missense probably benign 0.00
R6246:Pdhx UTSW 2 103046792 missense probably damaging 1.00
R6850:Pdhx UTSW 2 103041100 missense probably damaging 1.00
R7141:Pdhx UTSW 2 103073314 missense probably benign 0.21
R7219:Pdhx UTSW 2 103028415 missense probably benign 0.01
R7460:Pdhx UTSW 2 103046779 missense probably damaging 1.00
R7552:Pdhx UTSW 2 103046754 missense probably benign 0.01
R8325:Pdhx UTSW 2 103042252 missense probably benign 0.08
R9163:Pdhx UTSW 2 103022216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTACGCAAGCGCACATAC -3'
(R):5'- CTGAGACTCATTTTAGCTTCAGTG -3'

Sequencing Primer
(F):5'- GGGGCATATAATCTTCGCAAGTCC -3'
(R):5'- GCTTCAGTGTTAAGAATTCATTTTCC -3'
Posted On 2016-06-21