Incidental Mutation 'R5076:Pdhx'
ID 395743
Institutional Source Beutler Lab
Gene Symbol Pdhx
Ensembl Gene ENSMUSG00000010914
Gene Name pyruvate dehydrogenase complex, component X
Synonyms Pdx1
MMRRC Submission 042665-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5076 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 102851420-102903858 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 102871422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 203 (T203A)
Ref Sequence ENSEMBL: ENSMUSP00000106814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011058] [ENSMUST00000111183] [ENSMUST00000132449]
AlphaFold Q8BKZ9
Predicted Effect possibly damaging
Transcript: ENSMUST00000011058
AA Change: T203A

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000011058
Gene: ENSMUSG00000010914
AA Change: T203A

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:Biotin_lipoyl 57 131 1.3e-21 PFAM
low complexity region 148 172 N/A INTRINSIC
Pfam:E3_binding 182 217 5e-9 PFAM
low complexity region 233 249 N/A INTRINSIC
Pfam:2-oxoacid_dh 272 501 8.4e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111183
AA Change: T203A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106814
Gene: ENSMUSG00000010914
AA Change: T203A

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:Biotin_lipoyl 57 131 1.8e-21 PFAM
low complexity region 148 172 N/A INTRINSIC
Pfam:E3_binding 180 216 6.9e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000132449
AA Change: T138A

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119172
Gene: ENSMUSG00000010914
AA Change: T138A

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 5 66 1.3e-14 PFAM
low complexity region 83 107 N/A INTRINSIC
Pfam:E3_binding 115 153 6.1e-14 PFAM
low complexity region 168 184 N/A INTRINSIC
Meta Mutation Damage Score 0.3151 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pyruvate dehydrogenase (PDH) complex is located in the mitochondrial matrix and catalyzes the conversion of pyruvate to acetyl coenzyme A. The PDH complex thereby links glycolysis to Krebs cycle. The PDH complex contains three catalytic subunits, E1, E2, and E3, two regulatory subunits, E1 kinase and E1 phosphatase, and a non-catalytic subunit, E3 binding protein (E3BP). This gene encodes the E3 binding protein subunit; also known as component X of the pyruvate dehydrogenase complex. This protein tethers E3 dimers to the E2 core of the PDH complex. Defects in this gene are a cause of pyruvate dehydrogenase deficiency which results in neurological dysfunction and lactic acidosis in infancy and early childhood. This protein is also a minor antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC eventually leads to cirrhosis and liver failure. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 89,963,559 (GRCm39) I72V probably benign Het
Aadacl3 G A 4: 144,182,640 (GRCm39) P276L possibly damaging Het
Acp6 T A 3: 97,075,305 (GRCm39) S180T probably benign Het
Adgrd1 A T 5: 129,221,053 (GRCm39) R449* probably null Het
Ak1 T C 2: 32,523,460 (GRCm39) V176A probably damaging Het
Capzb A T 4: 139,015,125 (GRCm39) D226V possibly damaging Het
Cd34 A T 1: 194,630,338 (GRCm39) probably benign Het
Cdh15 C A 8: 123,591,087 (GRCm39) D445E possibly damaging Het
Chil4 A G 3: 106,109,913 (GRCm39) F367L probably damaging Het
Clstn2 T C 9: 97,365,132 (GRCm39) Y458C probably damaging Het
Cplane2 A G 4: 140,944,696 (GRCm39) I82M probably benign Het
Ctsw T C 19: 5,518,486 (GRCm39) Y9C probably benign Het
Dhrs7 T C 12: 72,706,255 (GRCm39) D50G probably benign Het
Dnah14 A G 1: 181,584,799 (GRCm39) K3177E probably benign Het
Ehd1 T C 19: 6,327,251 (GRCm39) F83L probably benign Het
Eif5a2 G A 3: 28,836,886 (GRCm39) V59I possibly damaging Het
Emilin3 T A 2: 160,751,238 (GRCm39) probably null Het
Entpd8 A G 2: 24,975,066 (GRCm39) S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 (GRCm39) G493D probably damaging Het
Gm11596 C T 11: 99,683,698 (GRCm39) G141R unknown Het
Gpi-ps T G 8: 5,690,130 (GRCm39) noncoding transcript Het
H2-Q4 T C 17: 35,599,417 (GRCm39) Y167H probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Itpr1 A G 6: 108,382,490 (GRCm39) probably null Het
Kif2c A T 4: 117,032,066 (GRCm39) probably benign Het
Klrb1-ps1 C T 6: 129,096,751 (GRCm39) noncoding transcript Het
Krtap9-5 A T 11: 99,840,294 (GRCm39) T332S unknown Het
Lrrc39 A T 3: 116,373,189 (GRCm39) E283V probably benign Het
Mdga1 A G 17: 30,069,528 (GRCm39) S447P possibly damaging Het
Mindy1 G A 3: 95,202,710 (GRCm39) V425M probably benign Het
Mllt6 G A 11: 97,560,326 (GRCm39) S210N possibly damaging Het
Mrps5 T A 2: 127,442,772 (GRCm39) Y280* probably null Het
Muc3a T A 5: 137,244,997 (GRCm39) T159S probably damaging Het
Or10ad1b T A 15: 98,124,642 (GRCm39) I295F probably damaging Het
Or4a79 T A 2: 89,551,745 (GRCm39) T237S probably damaging Het
Or4f6 A T 2: 111,838,937 (GRCm39) M198K probably damaging Het
Pcdhga4 G A 18: 37,818,648 (GRCm39) V66I probably benign Het
Pdss1 A G 2: 22,789,929 (GRCm39) probably null Het
Pdxk G T 10: 78,286,141 (GRCm39) Q103K probably benign Het
Peg3 A G 7: 6,711,419 (GRCm39) C1268R probably damaging Het
Pitpnc1 A T 11: 107,187,093 (GRCm39) S77T probably damaging Het
Pnisr T A 4: 21,874,990 (GRCm39) probably benign Het
Poc1b C T 10: 98,943,703 (GRCm39) T22I probably damaging Het
Ppfia1 G A 7: 144,060,001 (GRCm39) R604W probably damaging Het
Ppp1r3a A G 6: 14,754,680 (GRCm39) F189S probably damaging Het
Rbks T A 5: 31,807,795 (GRCm39) Y99* probably null Het
Sh3rf2 G T 18: 42,186,989 (GRCm39) C36F probably damaging Het
Spock3 T A 8: 63,798,889 (GRCm39) N303K probably damaging Het
Tasor2 C T 13: 3,626,357 (GRCm39) V1198I probably benign Het
Tcaf2 T C 6: 42,606,401 (GRCm39) T518A probably benign Het
Tmem163 A T 1: 127,428,013 (GRCm39) V191D probably damaging Het
Trappc6b A G 12: 59,097,094 (GRCm39) V76A probably damaging Het
Ube2nl A G 7: 61,199,280 (GRCm39) noncoding transcript Het
Unc5d C T 8: 29,184,704 (GRCm39) V599M possibly damaging Het
Vmn1r184 A T 7: 25,966,346 (GRCm39) M31L probably benign Het
Vrtn C A 12: 84,696,248 (GRCm39) Q333K probably damaging Het
Zfp788 T A 7: 41,298,008 (GRCm39) F163I possibly damaging Het
Zfyve1 C T 12: 83,602,421 (GRCm39) R458H probably damaging Het
Other mutations in Pdhx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Pdhx APN 2 102,860,686 (GRCm39) unclassified probably benign
IGL02450:Pdhx APN 2 102,872,594 (GRCm39) missense probably benign 0.00
R0152:Pdhx UTSW 2 102,858,625 (GRCm39) missense probably benign 0.04
R0317:Pdhx UTSW 2 102,858,625 (GRCm39) missense probably benign 0.04
R2351:Pdhx UTSW 2 102,854,562 (GRCm39) nonsense probably null
R3937:Pdhx UTSW 2 102,852,564 (GRCm39) missense probably damaging 1.00
R3950:Pdhx UTSW 2 102,865,586 (GRCm39) missense probably damaging 0.99
R4546:Pdhx UTSW 2 102,903,742 (GRCm39) missense probably null 0.99
R4677:Pdhx UTSW 2 102,903,811 (GRCm39) splice site probably null
R4744:Pdhx UTSW 2 102,872,641 (GRCm39) missense probably benign 0.01
R4996:Pdhx UTSW 2 102,860,657 (GRCm39) missense probably damaging 1.00
R5000:Pdhx UTSW 2 102,871,385 (GRCm39) splice site probably null
R5682:Pdhx UTSW 2 102,865,685 (GRCm39) missense probably benign 0.00
R6246:Pdhx UTSW 2 102,877,137 (GRCm39) missense probably damaging 1.00
R6850:Pdhx UTSW 2 102,871,445 (GRCm39) missense probably damaging 1.00
R7141:Pdhx UTSW 2 102,903,659 (GRCm39) missense probably benign 0.21
R7219:Pdhx UTSW 2 102,858,760 (GRCm39) missense probably benign 0.01
R7460:Pdhx UTSW 2 102,877,124 (GRCm39) missense probably damaging 1.00
R7552:Pdhx UTSW 2 102,877,099 (GRCm39) missense probably benign 0.01
R8325:Pdhx UTSW 2 102,872,597 (GRCm39) missense probably benign 0.08
R9163:Pdhx UTSW 2 102,852,561 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTACGCAAGCGCACATAC -3'
(R):5'- CTGAGACTCATTTTAGCTTCAGTG -3'

Sequencing Primer
(F):5'- GGGGCATATAATCTTCGCAAGTCC -3'
(R):5'- GCTTCAGTGTTAAGAATTCATTTTCC -3'
Posted On 2016-06-21