Mutagenetix > Incidental Mutation

Incidental Mutation 'R5076:Mrps5'

395745

Institutional Source

Beutler Lab

Gene Symbol

Mrps5

Ensembl Gene

ENSMUSG00000027374

Gene Name

mitochondrial ribosomal protein S5

Synonyms

MMRRC Submission

042665-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5076 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127587222-127606829 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 127600852 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 280 (Y280*)

Ref Sequence

ENSEMBL: ENSMUSP00000028852 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028852]

AlphaFold

Q99N87

Predicted Effect

probably null
Transcript: ENSMUST00000028852
AA Change: Y280*

SMART Domains

Protein: ENSMUSP00000028852
Gene: ENSMUSG00000027374
AA Change: Y280*

Domain	Start	End	E-Value	Type
low complexity region	108	126	N/A	INTRINSIC
Pfam:Ribosomal_S5	220	285	3.5e-20	PFAM
Pfam:Ribosomal_S5_C	297	368	4.7e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126491

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128535

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129066

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134101

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145271

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.0%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S5P family. Pseudogenes corresponding to this gene are found on chromosomes 4q, 5q, and 18q. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933434E20Rik	A	G	3: 90,056,252	I72V	probably benign	Het
Aadacl3	G	A	4: 144,456,070	P276L	possibly damaging	Het
Acp6	T	A	3: 97,167,989	S180T	probably benign	Het
Adgrd1	A	T	5: 129,143,989	R449*	probably null	Het
Ak1	T	C	2: 32,633,448	V176A	probably damaging	Het
Capzb	A	T	4: 139,287,814	D226V	possibly damaging	Het
Cd34	A	T	1: 194,948,030		probably benign	Het
Cdh15	C	A	8: 122,864,348	D445E	possibly damaging	Het
Chil4	A	G	3: 106,202,597	F367L	probably damaging	Het
Clstn2	T	C	9: 97,483,079	Y458C	probably damaging	Het
Ctsw	T	C	19: 5,468,458	Y9C	probably benign	Het
Dhrs7	T	C	12: 72,659,481	D50G	probably benign	Het
Dnah14	A	G	1: 181,757,234	K3177E	probably benign	Het
Ehd1	T	C	19: 6,277,221	F83L	probably benign	Het
Eif5a2	G	A	3: 28,782,737	V59I	possibly damaging	Het
Emilin3	T	A	2: 160,909,318		probably null	Het
Entpd8	A	G	2: 25,085,054	S426G	possibly damaging	Het
Epb41l4b	C	T	4: 57,040,984	G493D	probably damaging	Het
Fam208b	C	T	13: 3,576,357	V1198I	probably benign	Het
Gm11596	C	T	11: 99,792,872	G141R	unknown	Het
Gm1840	T	G	8: 5,640,130		noncoding transcript	Het
H2-Q4	T	C	17: 35,380,441	Y167H	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Itpr1	A	G	6: 108,405,529		probably null	Het
Kif2c	A	T	4: 117,174,869		probably benign	Het
Klrb1-ps1	C	T	6: 129,119,788		noncoding transcript	Het
Krtap9-5	A	T	11: 99,949,468	T332S	unknown	Het
Lrrc39	A	T	3: 116,579,540	E283V	probably benign	Het
Mdga1	A	G	17: 29,850,554	S447P	possibly damaging	Het
Mindy1	G	A	3: 95,295,399	V425M	probably benign	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Muc3a	T	A	5: 137,210,540	T159S	probably damaging	Het
Olfr1252	T	A	2: 89,721,401	T237S	probably damaging	Het
Olfr1310	A	T	2: 112,008,592	M198K	probably damaging	Het
Olfr286	T	A	15: 98,226,761	I295F	probably damaging	Het
Pcdhga4	G	A	18: 37,685,595	V66I	probably benign	Het
Pdhx	T	C	2: 103,041,077	T203A	probably damaging	Het
Pdss1	A	G	2: 22,899,917		probably null	Het
Pdxk	G	T	10: 78,450,307	Q103K	probably benign	Het
Peg3	A	G	7: 6,708,420	C1268R	probably damaging	Het
Pitpnc1	A	T	11: 107,296,267	S77T	probably damaging	Het
Pnisr	T	A	4: 21,874,990		probably benign	Het
Poc1b	C	T	10: 99,107,841	T22I	probably damaging	Het
Ppfia1	G	A	7: 144,506,264	R604W	probably damaging	Het
Ppp1r3a	A	G	6: 14,754,681	F189S	probably damaging	Het
Rbks	T	A	5: 31,650,451	Y99*	probably null	Het
Rsg1	A	G	4: 141,217,385	I82M	probably benign	Het
Sh3rf2	G	T	18: 42,053,924	C36F	probably damaging	Het
Spock3	T	A	8: 63,345,855	N303K	probably damaging	Het
Tcaf2	T	C	6: 42,629,467	T518A	probably benign	Het
Tmem163	A	T	1: 127,500,276	V191D	probably damaging	Het
Trappc6b	A	G	12: 59,050,308	V76A	probably damaging	Het
Ube2nl	A	G	7: 61,549,532		noncoding transcript	Het
Unc5d	C	T	8: 28,694,676	V599M	possibly damaging	Het
Vmn1r184	A	T	7: 26,266,921	M31L	probably benign	Het
Vrtn	C	A	12: 84,649,474	Q333K	probably damaging	Het
Zfp788	T	A	7: 41,648,584	F163I	possibly damaging	Het
Zfyve1	C	T	12: 83,555,647	R458H	probably damaging	Het

Other mutations in Mrps5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01968:Mrps5	APN	2	127591907	missense	probably null	0.01
IGL03348:Mrps5	APN	2	127601385	missense	probably damaging	0.98
R0369:Mrps5	UTSW	2	127591829	missense	probably benign	0.09
R0485:Mrps5	UTSW	2	127591825	missense	possibly damaging	0.56
R0622:Mrps5	UTSW	2	127594531	missense	probably benign	0.00
R1954:Mrps5	UTSW	2	127596897	splice site	probably null
R2182:Mrps5	UTSW	2	127602487	missense	probably damaging	1.00
R3414:Mrps5	UTSW	2	127596912	missense	probably benign	0.38
R4007:Mrps5	UTSW	2	127591835	missense	possibly damaging	0.81
R4687:Mrps5	UTSW	2	127590770	missense	probably benign	0.44
R4780:Mrps5	UTSW	2	127598241	missense	probably benign	0.00
R4835:Mrps5	UTSW	2	127603707	missense	possibly damaging	0.84
R4851:Mrps5	UTSW	2	127590745	missense	probably benign	0.00
R5558:Mrps5	UTSW	2	127602435	missense	probably damaging	1.00
R6192:Mrps5	UTSW	2	127601385	missense	probably damaging	0.98
R7038:Mrps5	UTSW	2	127600866	missense	probably damaging	1.00
R7071:Mrps5	UTSW	2	127600852	nonsense	probably null
R7103:Mrps5	UTSW	2	127601410	missense	probably damaging	0.99
R7177:Mrps5	UTSW	2	127595697	missense	probably benign
R7319:Mrps5	UTSW	2	127595842	missense	possibly damaging	0.94
R7387:Mrps5	UTSW	2	127600884	missense	probably damaging	1.00
R7460:Mrps5	UTSW	2	127591891	missense	not run
R8211:Mrps5	UTSW	2	127603724	missense	probably benign
R9052:Mrps5	UTSW	2	127591956	splice site	probably benign
R9358:Mrps5	UTSW	2	127595814	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- ACCCTGACTTAAAGGTTGAACC -3'
(R):5'- TGCAGACCTCAGGACAAATG -3'

Sequencing Primer
(F):5'- GGTCTCTCTAAATAGCCCTAGAACTC -3'
(R):5'- ATGACACGGTCTGCAGTG -3'

Posted On

2016-06-21