Incidental Mutation 'R5076:4933434E20Rik'
ID 395749
Institutional Source Beutler Lab
Gene Symbol 4933434E20Rik
Ensembl Gene ENSMUSG00000027942
Gene Name RIKEN cDNA 4933434E20 gene
Synonyms
MMRRC Submission 042665-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5076 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 89958941-89969754 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89963559 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 72 (I72V)
Ref Sequence ENSEMBL: ENSMUSP00000124822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029552] [ENSMUST00000029553] [ENSMUST00000064639] [ENSMUST00000068798] [ENSMUST00000090908] [ENSMUST00000159064] [ENSMUST00000160640] [ENSMUST00000162114] [ENSMUST00000196843] [ENSMUST00000161918] [ENSMUST00000199929] [ENSMUST00000196633] [ENSMUST00000198322] [ENSMUST00000197903] [ENSMUST00000195995] [ENSMUST00000199834]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000029552
AA Change: I72V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000029552
Gene: ENSMUSG00000027942
AA Change: I72V

DomainStartEndE-ValueType
Pfam:NICE-3 1 189 1.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029553
SMART Domains Protein: ENSMUSP00000029553
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064639
SMART Domains Protein: ENSMUSP00000066138
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 394 403 N/A INTRINSIC
low complexity region 405 414 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Pfam:DUF3697 520 551 4.1e-18 PFAM
low complexity region 559 594 N/A INTRINSIC
low complexity region 670 680 N/A INTRINSIC
low complexity region 719 750 N/A INTRINSIC
low complexity region 753 809 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1043 1056 N/A INTRINSIC
low complexity region 1077 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068798
AA Change: I72V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000066840
Gene: ENSMUSG00000027942
AA Change: I72V

DomainStartEndE-ValueType
Pfam:NICE-3 1 171 2.6e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090908
SMART Domains Protein: ENSMUSP00000088424
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159064
AA Change: I72V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124554
Gene: ENSMUSG00000027942
AA Change: I72V

DomainStartEndE-ValueType
Pfam:NICE-3 6 188 4.2e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159202
SMART Domains Protein: ENSMUSP00000123777
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 1 61 2.3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160263
Predicted Effect probably benign
Transcript: ENSMUST00000160640
AA Change: I72V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124028
Gene: ENSMUSG00000027942
AA Change: I72V

DomainStartEndE-ValueType
Pfam:NICE-3 1 189 3.2e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161874
Predicted Effect probably benign
Transcript: ENSMUST00000162114
AA Change: I72V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124822
Gene: ENSMUSG00000027942
AA Change: I72V

DomainStartEndE-ValueType
Pfam:NICE-3 1 189 1.4e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162390
Predicted Effect probably benign
Transcript: ENSMUST00000196843
SMART Domains Protein: ENSMUSP00000143459
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
low complexity region 1072 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161918
SMART Domains Protein: ENSMUSP00000123740
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 1 64 2.2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199929
SMART Domains Protein: ENSMUSP00000142488
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PDB:1WJ7|A 31 57 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000196633
SMART Domains Protein: ENSMUSP00000143423
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 6.3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198322
SMART Domains Protein: ENSMUSP00000142524
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 369 378 N/A INTRINSIC
low complexity region 380 389 N/A INTRINSIC
low complexity region 439 464 N/A INTRINSIC
Pfam:DUF3697 494 526 4.1e-22 PFAM
low complexity region 534 569 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
low complexity region 694 725 N/A INTRINSIC
low complexity region 728 784 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197903
SMART Domains Protein: ENSMUSP00000143519
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PDB:1WJ7|A 31 81 7e-32 PDB
Blast:UBA 50 81 7e-16 BLAST
SCOP:d1efub3 51 81 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195995
SMART Domains Protein: ENSMUSP00000143638
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 526 557 3.7e-18 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199834
SMART Domains Protein: ENSMUSP00000143254
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Meta Mutation Damage Score 0.1084 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 G A 4: 144,182,640 (GRCm39) P276L possibly damaging Het
Acp6 T A 3: 97,075,305 (GRCm39) S180T probably benign Het
Adgrd1 A T 5: 129,221,053 (GRCm39) R449* probably null Het
Ak1 T C 2: 32,523,460 (GRCm39) V176A probably damaging Het
Capzb A T 4: 139,015,125 (GRCm39) D226V possibly damaging Het
Cd34 A T 1: 194,630,338 (GRCm39) probably benign Het
Cdh15 C A 8: 123,591,087 (GRCm39) D445E possibly damaging Het
Chil4 A G 3: 106,109,913 (GRCm39) F367L probably damaging Het
Clstn2 T C 9: 97,365,132 (GRCm39) Y458C probably damaging Het
Cplane2 A G 4: 140,944,696 (GRCm39) I82M probably benign Het
Ctsw T C 19: 5,518,486 (GRCm39) Y9C probably benign Het
Dhrs7 T C 12: 72,706,255 (GRCm39) D50G probably benign Het
Dnah14 A G 1: 181,584,799 (GRCm39) K3177E probably benign Het
Ehd1 T C 19: 6,327,251 (GRCm39) F83L probably benign Het
Eif5a2 G A 3: 28,836,886 (GRCm39) V59I possibly damaging Het
Emilin3 T A 2: 160,751,238 (GRCm39) probably null Het
Entpd8 A G 2: 24,975,066 (GRCm39) S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 (GRCm39) G493D probably damaging Het
Gm11596 C T 11: 99,683,698 (GRCm39) G141R unknown Het
Gpi-ps T G 8: 5,690,130 (GRCm39) noncoding transcript Het
H2-Q4 T C 17: 35,599,417 (GRCm39) Y167H probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Itpr1 A G 6: 108,382,490 (GRCm39) probably null Het
Kif2c A T 4: 117,032,066 (GRCm39) probably benign Het
Klrb1-ps1 C T 6: 129,096,751 (GRCm39) noncoding transcript Het
Krtap9-5 A T 11: 99,840,294 (GRCm39) T332S unknown Het
Lrrc39 A T 3: 116,373,189 (GRCm39) E283V probably benign Het
Mdga1 A G 17: 30,069,528 (GRCm39) S447P possibly damaging Het
Mindy1 G A 3: 95,202,710 (GRCm39) V425M probably benign Het
Mllt6 G A 11: 97,560,326 (GRCm39) S210N possibly damaging Het
Mrps5 T A 2: 127,442,772 (GRCm39) Y280* probably null Het
Muc3a T A 5: 137,244,997 (GRCm39) T159S probably damaging Het
Or10ad1b T A 15: 98,124,642 (GRCm39) I295F probably damaging Het
Or4a79 T A 2: 89,551,745 (GRCm39) T237S probably damaging Het
Or4f6 A T 2: 111,838,937 (GRCm39) M198K probably damaging Het
Pcdhga4 G A 18: 37,818,648 (GRCm39) V66I probably benign Het
Pdhx T C 2: 102,871,422 (GRCm39) T203A probably damaging Het
Pdss1 A G 2: 22,789,929 (GRCm39) probably null Het
Pdxk G T 10: 78,286,141 (GRCm39) Q103K probably benign Het
Peg3 A G 7: 6,711,419 (GRCm39) C1268R probably damaging Het
Pitpnc1 A T 11: 107,187,093 (GRCm39) S77T probably damaging Het
Pnisr T A 4: 21,874,990 (GRCm39) probably benign Het
Poc1b C T 10: 98,943,703 (GRCm39) T22I probably damaging Het
Ppfia1 G A 7: 144,060,001 (GRCm39) R604W probably damaging Het
Ppp1r3a A G 6: 14,754,680 (GRCm39) F189S probably damaging Het
Rbks T A 5: 31,807,795 (GRCm39) Y99* probably null Het
Sh3rf2 G T 18: 42,186,989 (GRCm39) C36F probably damaging Het
Spock3 T A 8: 63,798,889 (GRCm39) N303K probably damaging Het
Tasor2 C T 13: 3,626,357 (GRCm39) V1198I probably benign Het
Tcaf2 T C 6: 42,606,401 (GRCm39) T518A probably benign Het
Tmem163 A T 1: 127,428,013 (GRCm39) V191D probably damaging Het
Trappc6b A G 12: 59,097,094 (GRCm39) V76A probably damaging Het
Ube2nl A G 7: 61,199,280 (GRCm39) noncoding transcript Het
Unc5d C T 8: 29,184,704 (GRCm39) V599M possibly damaging Het
Vmn1r184 A T 7: 25,966,346 (GRCm39) M31L probably benign Het
Vrtn C A 12: 84,696,248 (GRCm39) Q333K probably damaging Het
Zfp788 T A 7: 41,298,008 (GRCm39) F163I possibly damaging Het
Zfyve1 C T 12: 83,602,421 (GRCm39) R458H probably damaging Het
Other mutations in 4933434E20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:4933434E20Rik APN 3 89,960,400 (GRCm39) missense possibly damaging 0.65
IGL01621:4933434E20Rik APN 3 89,971,809 (GRCm39) missense possibly damaging 0.82
IGL01984:4933434E20Rik APN 3 89,970,537 (GRCm39) missense probably benign 0.00
IGL02005:4933434E20Rik APN 3 89,965,927 (GRCm39) missense probably damaging 1.00
R0446:4933434E20Rik UTSW 3 89,971,766 (GRCm39) missense probably benign 0.00
R1717:4933434E20Rik UTSW 3 89,963,544 (GRCm39) missense probably benign 0.23
R1816:4933434E20Rik UTSW 3 89,960,398 (GRCm39) missense possibly damaging 0.89
R2170:4933434E20Rik UTSW 3 89,963,611 (GRCm39) missense probably benign 0.07
R2299:4933434E20Rik UTSW 3 89,971,845 (GRCm39) missense possibly damaging 0.88
R2981:4933434E20Rik UTSW 3 89,965,938 (GRCm39) missense probably benign 0.00
R3879:4933434E20Rik UTSW 3 89,970,561 (GRCm39) unclassified probably benign
R4065:4933434E20Rik UTSW 3 89,966,073 (GRCm39) nonsense probably null
R4724:4933434E20Rik UTSW 3 89,960,890 (GRCm39) missense probably damaging 0.99
R4724:4933434E20Rik UTSW 3 89,960,849 (GRCm39) missense probably damaging 1.00
R4724:4933434E20Rik UTSW 3 89,960,848 (GRCm39) missense probably damaging 1.00
R4835:4933434E20Rik UTSW 3 89,970,516 (GRCm39) missense probably benign 0.22
R6126:4933434E20Rik UTSW 3 89,963,881 (GRCm39) missense probably damaging 0.98
R6337:4933434E20Rik UTSW 3 89,969,040 (GRCm39) missense probably benign 0.03
R6562:4933434E20Rik UTSW 3 89,970,543 (GRCm39) missense probably benign 0.38
R7312:4933434E20Rik UTSW 3 89,969,021 (GRCm39) missense probably benign 0.07
R7316:4933434E20Rik UTSW 3 89,969,020 (GRCm39) missense probably benign
R7473:4933434E20Rik UTSW 3 89,965,960 (GRCm39) critical splice donor site probably null
R7990:4933434E20Rik UTSW 3 89,970,549 (GRCm39) missense probably damaging 0.98
R8125:4933434E20Rik UTSW 3 89,972,818 (GRCm39) missense possibly damaging 0.92
R9268:4933434E20Rik UTSW 3 89,969,030 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCCTGAAGAGTGGATTGTGTATTAAAC -3'
(R):5'- CAGATAGTTGTAGCAACCTATTGAG -3'

Sequencing Primer
(F):5'- GGTACTCACTTTGTAGACCAGGC -3'
(R):5'- AGACTAGTCTTAGTGATCACTTGC -3'
Posted On 2016-06-21