Incidental Mutation 'R5076:Pnisr'
ID395753
Institutional Source Beutler Lab
Gene Symbol Pnisr
Ensembl Gene ENSMUSG00000028248
Gene NamePNN interacting serine/arginine-rich
SynonymsSfrs18, 5730406M06Rik
MMRRC Submission 042665-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R5076 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location21847583-21876475 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 21874990 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029909] [ENSMUST00000029911] [ENSMUST00000098238] [ENSMUST00000108229] [ENSMUST00000185001]
Predicted Effect probably benign
Transcript: ENSMUST00000029909
SMART Domains Protein: ENSMUSP00000029909
Gene: ENSMUSG00000028247

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:Ubie_methyltran 116 278 2.2e-8 PFAM
Pfam:Methyltransf_23 122 305 1.4e-24 PFAM
Pfam:PrmA 143 262 2.4e-7 PFAM
Pfam:CMAS 144 338 3.9e-12 PFAM
Pfam:Methyltransf_31 145 305 4.3e-16 PFAM
Pfam:Methyltransf_18 147 254 8.3e-16 PFAM
Pfam:Methyltransf_25 151 247 5e-10 PFAM
Pfam:Methyltransf_12 152 249 1.2e-15 PFAM
Pfam:Methyltransf_11 152 251 1.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029911
SMART Domains Protein: ENSMUSP00000029911
Gene: ENSMUSG00000028248

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
internal_repeat_1 57 86 6.59e-5 PROSPERO
low complexity region 94 117 N/A INTRINSIC
internal_repeat_1 121 149 6.59e-5 PROSPERO
low complexity region 181 194 N/A INTRINSIC
Pfam:PNISR 223 391 1.1e-55 PFAM
low complexity region 429 449 N/A INTRINSIC
low complexity region 494 586 N/A INTRINSIC
low complexity region 592 640 N/A INTRINSIC
low complexity region 664 703 N/A INTRINSIC
low complexity region 746 783 N/A INTRINSIC
low complexity region 789 814 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098238
SMART Domains Protein: ENSMUSP00000095840
Gene: ENSMUSG00000028248

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
internal_repeat_1 57 86 7.37e-5 PROSPERO
low complexity region 94 117 N/A INTRINSIC
internal_repeat_1 121 149 7.37e-5 PROSPERO
low complexity region 181 194 N/A INTRINSIC
coiled coil region 240 276 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
low complexity region 376 415 N/A INTRINSIC
low complexity region 429 449 N/A INTRINSIC
low complexity region 494 586 N/A INTRINSIC
low complexity region 592 640 N/A INTRINSIC
low complexity region 664 703 N/A INTRINSIC
low complexity region 746 783 N/A INTRINSIC
low complexity region 789 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108229
SMART Domains Protein: ENSMUSP00000103864
Gene: ENSMUSG00000028248

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
low complexity region 94 117 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
coiled coil region 240 276 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148561
Predicted Effect probably benign
Transcript: ENSMUST00000185001
SMART Domains Protein: ENSMUSP00000139324
Gene: ENSMUSG00000028248

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
low complexity region 94 117 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
coiled coil region 240 276 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,056,252 I72V probably benign Het
Aadacl3 G A 4: 144,456,070 P276L possibly damaging Het
Acp6 T A 3: 97,167,989 S180T probably benign Het
Adgrd1 A T 5: 129,143,989 R449* probably null Het
Ak1 T C 2: 32,633,448 V176A probably damaging Het
Capzb A T 4: 139,287,814 D226V possibly damaging Het
Cd34 A T 1: 194,948,030 probably benign Het
Cdh15 C A 8: 122,864,348 D445E possibly damaging Het
Chil4 A G 3: 106,202,597 F367L probably damaging Het
Clstn2 T C 9: 97,483,079 Y458C probably damaging Het
Ctsw T C 19: 5,468,458 Y9C probably benign Het
Dhrs7 T C 12: 72,659,481 D50G probably benign Het
Dnah14 A G 1: 181,757,234 K3177E probably benign Het
Ehd1 T C 19: 6,277,221 F83L probably benign Het
Eif5a2 G A 3: 28,782,737 V59I possibly damaging Het
Emilin3 T A 2: 160,909,318 probably null Het
Entpd8 A G 2: 25,085,054 S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 G493D probably damaging Het
Fam208b C T 13: 3,576,357 V1198I probably benign Het
Gm11596 C T 11: 99,792,872 G141R unknown Het
Gm1840 T G 8: 5,640,130 noncoding transcript Het
H2-Q4 T C 17: 35,380,441 Y167H probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Itpr1 A G 6: 108,405,529 probably null Het
Kif2c A T 4: 117,174,869 probably benign Het
Klrb1-ps1 C T 6: 129,119,788 noncoding transcript Het
Krtap9-5 A T 11: 99,949,468 T332S unknown Het
Lrrc39 A T 3: 116,579,540 E283V probably benign Het
Mdga1 A G 17: 29,850,554 S447P possibly damaging Het
Mindy1 G A 3: 95,295,399 V425M probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Muc3a T A 5: 137,210,540 T159S probably damaging Het
Olfr1252 T A 2: 89,721,401 T237S probably damaging Het
Olfr1310 A T 2: 112,008,592 M198K probably damaging Het
Olfr286 T A 15: 98,226,761 I295F probably damaging Het
Pcdhga4 G A 18: 37,685,595 V66I probably benign Het
Pdhx T C 2: 103,041,077 T203A probably damaging Het
Pdss1 A G 2: 22,899,917 probably null Het
Pdxk G T 10: 78,450,307 Q103K probably benign Het
Peg3 A G 7: 6,708,420 C1268R probably damaging Het
Pitpnc1 A T 11: 107,296,267 S77T probably damaging Het
Poc1b C T 10: 99,107,841 T22I probably damaging Het
Ppfia1 G A 7: 144,506,264 R604W probably damaging Het
Ppp1r3a A G 6: 14,754,681 F189S probably damaging Het
Rbks T A 5: 31,650,451 Y99* probably null Het
Rsg1 A G 4: 141,217,385 I82M probably benign Het
Sh3rf2 G T 18: 42,053,924 C36F probably damaging Het
Spock3 T A 8: 63,345,855 N303K probably damaging Het
Tcaf2 T C 6: 42,629,467 T518A probably benign Het
Tmem163 A T 1: 127,500,276 V191D probably damaging Het
Trappc6b A G 12: 59,050,308 V76A probably damaging Het
Ube2nl A G 7: 61,549,532 noncoding transcript Het
Unc5d C T 8: 28,694,676 V599M possibly damaging Het
Vmn1r184 A T 7: 26,266,921 M31L probably benign Het
Vrtn C A 12: 84,649,474 Q333K probably damaging Het
Zfp788 T A 7: 41,648,584 F163I possibly damaging Het
Zfyve1 C T 12: 83,555,647 R458H probably damaging Het
Other mutations in Pnisr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Pnisr APN 4 21870407 critical splice donor site probably null
IGL01467:Pnisr APN 4 21874650 unclassified probably benign
IGL01997:Pnisr APN 4 21871537 missense possibly damaging 0.95
IGL02641:Pnisr APN 4 21860908 missense probably benign 0.03
IGL02756:Pnisr APN 4 21862175 missense probably benign 0.07
R0106:Pnisr UTSW 4 21874617 unclassified probably benign
R0106:Pnisr UTSW 4 21874617 unclassified probably benign
R0620:Pnisr UTSW 4 21874092 unclassified probably benign
R0636:Pnisr UTSW 4 21873800 unclassified probably benign
R1179:Pnisr UTSW 4 21865937 missense possibly damaging 0.95
R1388:Pnisr UTSW 4 21862041 missense possibly damaging 0.88
R1450:Pnisr UTSW 4 21874912 critical splice acceptor site probably null
R1609:Pnisr UTSW 4 21871440 nonsense probably null
R1663:Pnisr UTSW 4 21873857 unclassified probably benign
R1670:Pnisr UTSW 4 21865893 missense probably damaging 1.00
R1721:Pnisr UTSW 4 21874086 unclassified probably benign
R1792:Pnisr UTSW 4 21860968 missense possibly damaging 0.94
R1867:Pnisr UTSW 4 21874086 unclassified probably benign
R1868:Pnisr UTSW 4 21874086 unclassified probably benign
R1909:Pnisr UTSW 4 21869517 missense possibly damaging 0.88
R1931:Pnisr UTSW 4 21873612 missense probably benign 0.01
R4843:Pnisr UTSW 4 21857400 intron probably benign
R4917:Pnisr UTSW 4 21859330 intron probably benign
R5164:Pnisr UTSW 4 21859237 missense possibly damaging 0.88
R5227:Pnisr UTSW 4 21874587 unclassified probably benign
R6722:Pnisr UTSW 4 21859165 missense probably damaging 0.99
R7878:Pnisr UTSW 4 21874370 missense unknown
R7961:Pnisr UTSW 4 21874370 missense unknown
Z1088:Pnisr UTSW 4 21873684 missense probably benign
Z1176:Pnisr UTSW 4 21873684 missense probably benign
Z1177:Pnisr UTSW 4 21873684 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGTCTAAGTCCCGATCAAGG -3'
(R):5'- CCTGTTATACAAAACTTCAGCTGC -3'

Sequencing Primer
(F):5'- CTAAGTCCCGATCAAGGTAGTATAC -3'
(R):5'- TGGAGCAGCATTTGGAAA -3'
Posted On2016-06-21