Incidental Mutation 'R5076:Capzb'
ID395757
Institutional Source Beutler Lab
Gene Symbol Capzb
Ensembl Gene ENSMUSG00000028745
Gene Namecapping protein (actin filament) muscle Z-line, beta
Synonyms1700120C01Rik, CPB2, Cappb1, CPbeta1, CPbeta2, CPB1
MMRRC Submission 042665-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5076 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location139192899-139291818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139287814 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 226 (D226V)
Ref Sequence ENSEMBL: ENSMUSP00000038011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030518] [ENSMUST00000042675] [ENSMUST00000102507] [ENSMUST00000102508] [ENSMUST00000138045]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030518
AA Change: D267V

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030518
Gene: ENSMUSG00000028745
AA Change: D267V

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 35 269 6.2e-114 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000042675
AA Change: D226V

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038011
Gene: ENSMUSG00000028745
AA Change: D226V

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 1 228 4.7e-111 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102507
AA Change: D238V

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099565
Gene: ENSMUSG00000028745
AA Change: D238V

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 6 240 4.6e-114 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102508
AA Change: D238V

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099566
Gene: ENSMUSG00000028745
AA Change: D238V

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 5 240 6.8e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132385
Predicted Effect probably benign
Transcript: ENSMUST00000138045
SMART Domains Protein: ENSMUSP00000122077
Gene: ENSMUSG00000028745

DomainStartEndE-ValueType
Pfam:F_actin_cap_B 1 204 9.8e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150077
Meta Mutation Damage Score 0.9414 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of a highly conserved filamentous actin capping protein that binds the barbed end of filamentous actin to stabilize it and terminate elongation. Interaction of this protein with the barbed end of the actin filament occurs through binding of the amphipathic helix at the C-terminus to the hydrophobic cleft on the actin molecule. This gene is required for a variety of dynamic actin-mediated processes including organization of lamellipodia and filopodia, growth cone morphology and neurite outgrowth in hippocampal neurons, and asymmetric spindle migration and polar body extrusion during oocyte maturation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in the ear exhibit increased ABR threshold, absent DPOE, reduced vestibular function, head shaking and abnormal stereocilia length and width in the cochlea and utricle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,056,252 I72V probably benign Het
Aadacl3 G A 4: 144,456,070 P276L possibly damaging Het
Acp6 T A 3: 97,167,989 S180T probably benign Het
Adgrd1 A T 5: 129,143,989 R449* probably null Het
Ak1 T C 2: 32,633,448 V176A probably damaging Het
Cd34 A T 1: 194,948,030 probably benign Het
Cdh15 C A 8: 122,864,348 D445E possibly damaging Het
Chil4 A G 3: 106,202,597 F367L probably damaging Het
Clstn2 T C 9: 97,483,079 Y458C probably damaging Het
Ctsw T C 19: 5,468,458 Y9C probably benign Het
Dhrs7 T C 12: 72,659,481 D50G probably benign Het
Dnah14 A G 1: 181,757,234 K3177E probably benign Het
Ehd1 T C 19: 6,277,221 F83L probably benign Het
Eif5a2 G A 3: 28,782,737 V59I possibly damaging Het
Emilin3 T A 2: 160,909,318 probably null Het
Entpd8 A G 2: 25,085,054 S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 G493D probably damaging Het
Fam208b C T 13: 3,576,357 V1198I probably benign Het
Gm11596 C T 11: 99,792,872 G141R unknown Het
Gm1840 T G 8: 5,640,130 noncoding transcript Het
H2-Q4 T C 17: 35,380,441 Y167H probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Itpr1 A G 6: 108,405,529 probably null Het
Kif2c A T 4: 117,174,869 probably benign Het
Klrb1-ps1 C T 6: 129,119,788 noncoding transcript Het
Krtap9-5 A T 11: 99,949,468 T332S unknown Het
Lrrc39 A T 3: 116,579,540 E283V probably benign Het
Mdga1 A G 17: 29,850,554 S447P possibly damaging Het
Mindy1 G A 3: 95,295,399 V425M probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Muc3a T A 5: 137,210,540 T159S probably damaging Het
Olfr1252 T A 2: 89,721,401 T237S probably damaging Het
Olfr1310 A T 2: 112,008,592 M198K probably damaging Het
Olfr286 T A 15: 98,226,761 I295F probably damaging Het
Pcdhga4 G A 18: 37,685,595 V66I probably benign Het
Pdhx T C 2: 103,041,077 T203A probably damaging Het
Pdss1 A G 2: 22,899,917 probably null Het
Pdxk G T 10: 78,450,307 Q103K probably benign Het
Peg3 A G 7: 6,708,420 C1268R probably damaging Het
Pitpnc1 A T 11: 107,296,267 S77T probably damaging Het
Pnisr T A 4: 21,874,990 probably benign Het
Poc1b C T 10: 99,107,841 T22I probably damaging Het
Ppfia1 G A 7: 144,506,264 R604W probably damaging Het
Ppp1r3a A G 6: 14,754,681 F189S probably damaging Het
Rbks T A 5: 31,650,451 Y99* probably null Het
Rsg1 A G 4: 141,217,385 I82M probably benign Het
Sh3rf2 G T 18: 42,053,924 C36F probably damaging Het
Spock3 T A 8: 63,345,855 N303K probably damaging Het
Tcaf2 T C 6: 42,629,467 T518A probably benign Het
Tmem163 A T 1: 127,500,276 V191D probably damaging Het
Trappc6b A G 12: 59,050,308 V76A probably damaging Het
Ube2nl A G 7: 61,549,532 noncoding transcript Het
Unc5d C T 8: 28,694,676 V599M possibly damaging Het
Vmn1r184 A T 7: 26,266,921 M31L probably benign Het
Vrtn C A 12: 84,649,474 Q333K probably damaging Het
Zfp788 T A 7: 41,648,584 F163I possibly damaging Het
Zfyve1 C T 12: 83,555,647 R458H probably damaging Het
Other mutations in Capzb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Capzb APN 4 139288947 missense probably benign 0.00
IGL00885:Capzb APN 4 139287050 missense probably benign 0.00
R0612:Capzb UTSW 4 139291029 missense probably benign
R0729:Capzb UTSW 4 139288977 unclassified probably benign
R1547:Capzb UTSW 4 139262098 splice site probably null
R1731:Capzb UTSW 4 139280030 missense probably damaging 1.00
R1748:Capzb UTSW 4 139257368 missense probably damaging 1.00
R2234:Capzb UTSW 4 139262023 missense possibly damaging 0.80
R2424:Capzb UTSW 4 139194130 start codon destroyed probably null 0.01
R4799:Capzb UTSW 4 139192999 utr 5 prime probably benign
R5596:Capzb UTSW 4 139279427 intron probably benign
R6200:Capzb UTSW 4 139280013 missense probably benign 0.33
R7587:Capzb UTSW 4 139262023 missense possibly damaging 0.80
R7763:Capzb UTSW 4 139280553 missense probably benign
X0012:Capzb UTSW 4 139257291 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CACAAATTATAGGTGGGGTTCTGG -3'
(R):5'- TCAAAGCTTGCTGTGGTCAG -3'

Sequencing Primer
(F):5'- TGGCATTGGCTCTCAACACAG -3'
(R):5'- TCAGTGAGCCCAGAGACCAG -3'
Posted On2016-06-21