Incidental Mutation 'R5076:Cplane2'
ID 395758
Institutional Source Beutler Lab
Gene Symbol Cplane2
Ensembl Gene ENSMUSG00000073733
Gene Name ciliogenesis and planar polarity effector 2
Synonyms Rsg1, b2b2827Clo, b2b2804Clo, 6330545A04Rik, LOC279260
MMRRC Submission 042665-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.316) question?
Stock # R5076 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 140941249-140947425 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 140944696 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 82 (I82M)
Ref Sequence ENSEMBL: ENSMUSP00000095422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097813]
AlphaFold A2A825
Predicted Effect probably benign
Transcript: ENSMUST00000097813
AA Change: I82M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095422
Gene: ENSMUSG00000073733
AA Change: I82M

DomainStartEndE-ValueType
Pfam:Roc 57 179 7.3e-9 PFAM
Pfam:Ras 57 207 4.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151475
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
MGI Phenotype PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular defects including persistent truncus arteriosus and atrioventricular septal defects, as well as polydactyly and micrognathia. Eye defects, hypoplastic lungs and thymus, and tracheoesophageal anomalies may be also present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 89,963,559 (GRCm39) I72V probably benign Het
Aadacl3 G A 4: 144,182,640 (GRCm39) P276L possibly damaging Het
Acp6 T A 3: 97,075,305 (GRCm39) S180T probably benign Het
Adgrd1 A T 5: 129,221,053 (GRCm39) R449* probably null Het
Ak1 T C 2: 32,523,460 (GRCm39) V176A probably damaging Het
Capzb A T 4: 139,015,125 (GRCm39) D226V possibly damaging Het
Cd34 A T 1: 194,630,338 (GRCm39) probably benign Het
Cdh15 C A 8: 123,591,087 (GRCm39) D445E possibly damaging Het
Chil4 A G 3: 106,109,913 (GRCm39) F367L probably damaging Het
Clstn2 T C 9: 97,365,132 (GRCm39) Y458C probably damaging Het
Ctsw T C 19: 5,518,486 (GRCm39) Y9C probably benign Het
Dhrs7 T C 12: 72,706,255 (GRCm39) D50G probably benign Het
Dnah14 A G 1: 181,584,799 (GRCm39) K3177E probably benign Het
Ehd1 T C 19: 6,327,251 (GRCm39) F83L probably benign Het
Eif5a2 G A 3: 28,836,886 (GRCm39) V59I possibly damaging Het
Emilin3 T A 2: 160,751,238 (GRCm39) probably null Het
Entpd8 A G 2: 24,975,066 (GRCm39) S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 (GRCm39) G493D probably damaging Het
Gm11596 C T 11: 99,683,698 (GRCm39) G141R unknown Het
Gpi-ps T G 8: 5,690,130 (GRCm39) noncoding transcript Het
H2-Q4 T C 17: 35,599,417 (GRCm39) Y167H probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Itpr1 A G 6: 108,382,490 (GRCm39) probably null Het
Kif2c A T 4: 117,032,066 (GRCm39) probably benign Het
Klrb1-ps1 C T 6: 129,096,751 (GRCm39) noncoding transcript Het
Krtap9-5 A T 11: 99,840,294 (GRCm39) T332S unknown Het
Lrrc39 A T 3: 116,373,189 (GRCm39) E283V probably benign Het
Mdga1 A G 17: 30,069,528 (GRCm39) S447P possibly damaging Het
Mindy1 G A 3: 95,202,710 (GRCm39) V425M probably benign Het
Mllt6 G A 11: 97,560,326 (GRCm39) S210N possibly damaging Het
Mrps5 T A 2: 127,442,772 (GRCm39) Y280* probably null Het
Muc3a T A 5: 137,244,997 (GRCm39) T159S probably damaging Het
Or10ad1b T A 15: 98,124,642 (GRCm39) I295F probably damaging Het
Or4a79 T A 2: 89,551,745 (GRCm39) T237S probably damaging Het
Or4f6 A T 2: 111,838,937 (GRCm39) M198K probably damaging Het
Pcdhga4 G A 18: 37,818,648 (GRCm39) V66I probably benign Het
Pdhx T C 2: 102,871,422 (GRCm39) T203A probably damaging Het
Pdss1 A G 2: 22,789,929 (GRCm39) probably null Het
Pdxk G T 10: 78,286,141 (GRCm39) Q103K probably benign Het
Peg3 A G 7: 6,711,419 (GRCm39) C1268R probably damaging Het
Pitpnc1 A T 11: 107,187,093 (GRCm39) S77T probably damaging Het
Pnisr T A 4: 21,874,990 (GRCm39) probably benign Het
Poc1b C T 10: 98,943,703 (GRCm39) T22I probably damaging Het
Ppfia1 G A 7: 144,060,001 (GRCm39) R604W probably damaging Het
Ppp1r3a A G 6: 14,754,680 (GRCm39) F189S probably damaging Het
Rbks T A 5: 31,807,795 (GRCm39) Y99* probably null Het
Sh3rf2 G T 18: 42,186,989 (GRCm39) C36F probably damaging Het
Spock3 T A 8: 63,798,889 (GRCm39) N303K probably damaging Het
Tasor2 C T 13: 3,626,357 (GRCm39) V1198I probably benign Het
Tcaf2 T C 6: 42,606,401 (GRCm39) T518A probably benign Het
Tmem163 A T 1: 127,428,013 (GRCm39) V191D probably damaging Het
Trappc6b A G 12: 59,097,094 (GRCm39) V76A probably damaging Het
Ube2nl A G 7: 61,199,280 (GRCm39) noncoding transcript Het
Unc5d C T 8: 29,184,704 (GRCm39) V599M possibly damaging Het
Vmn1r184 A T 7: 25,966,346 (GRCm39) M31L probably benign Het
Vrtn C A 12: 84,696,248 (GRCm39) Q333K probably damaging Het
Zfp788 T A 7: 41,298,008 (GRCm39) F163I possibly damaging Het
Zfyve1 C T 12: 83,602,421 (GRCm39) R458H probably damaging Het
Other mutations in Cplane2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Cplane2 APN 4 140,945,964 (GRCm39) missense probably benign 0.01
R0488:Cplane2 UTSW 4 140,941,712 (GRCm39) missense probably benign 0.05
R0967:Cplane2 UTSW 4 140,947,162 (GRCm39) missense probably benign 0.01
R1339:Cplane2 UTSW 4 140,945,859 (GRCm39) missense probably damaging 1.00
R1460:Cplane2 UTSW 4 140,945,523 (GRCm39) missense probably damaging 0.97
R3826:Cplane2 UTSW 4 140,945,900 (GRCm39) missense probably damaging 1.00
R3828:Cplane2 UTSW 4 140,945,900 (GRCm39) missense probably damaging 1.00
R3829:Cplane2 UTSW 4 140,945,900 (GRCm39) missense probably damaging 1.00
R3830:Cplane2 UTSW 4 140,945,900 (GRCm39) missense probably damaging 1.00
R5242:Cplane2 UTSW 4 140,947,158 (GRCm39) missense probably damaging 1.00
R5527:Cplane2 UTSW 4 140,947,303 (GRCm39) missense probably damaging 1.00
R5610:Cplane2 UTSW 4 140,947,177 (GRCm39) missense probably benign 0.00
R5677:Cplane2 UTSW 4 140,947,177 (GRCm39) missense probably benign 0.00
R6049:Cplane2 UTSW 4 140,945,473 (GRCm39) missense probably benign 0.18
R6543:Cplane2 UTSW 4 140,944,599 (GRCm39) missense probably benign
R7078:Cplane2 UTSW 4 140,947,159 (GRCm39) missense probably benign 0.01
R7483:Cplane2 UTSW 4 140,947,153 (GRCm39) missense probably damaging 1.00
R8046:Cplane2 UTSW 4 140,947,348 (GRCm39) missense probably damaging 1.00
R8169:Cplane2 UTSW 4 140,945,530 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCAGAACTGACTCCCAACTC -3'
(R):5'- CCCCACTAATATAGTCAGGGCG -3'

Sequencing Primer
(F):5'- TGACTCCCAACTCCCTGAC -3'
(R):5'- CCACTAATATAGTCAGGGCGAAGTTC -3'
Posted On 2016-06-21