Incidental Mutation 'R5076:Rbks'
ID 395760
Institutional Source Beutler Lab
Gene Symbol Rbks
Ensembl Gene ENSMUSG00000029136
Gene Name ribokinase
Synonyms 5230400M11Rik
MMRRC Submission 042665-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.307) question?
Stock # R5076 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 31781783-31854971 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 31807795 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 99 (Y99*)
Ref Sequence ENSEMBL: ENSMUSP00000144669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031018] [ENSMUST00000201910]
AlphaFold Q8R1Q9
Predicted Effect probably benign
Transcript: ENSMUST00000031018
SMART Domains Protein: ENSMUSP00000031018
Gene: ENSMUSG00000029136

DomainStartEndE-ValueType
Pfam:PfkB 16 315 2.1e-66 PFAM
Pfam:Phos_pyr_kin 166 306 9.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145264
AA Change: *138K
Predicted Effect probably null
Transcript: ENSMUST00000152261
AA Change: Y99*
SMART Domains Protein: ENSMUSP00000116693
Gene: ENSMUSG00000029142
AA Change: Y99*

DomainStartEndE-ValueType
PDB:4CE4|6 1 49 9e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201719
Predicted Effect probably null
Transcript: ENSMUST00000201910
AA Change: Y99*
SMART Domains Protein: ENSMUSP00000144669
Gene: ENSMUSG00000106918
AA Change: Y99*

DomainStartEndE-ValueType
PDB:4CE4|6 1 49 9e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202243
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carbohydrate kinase PfkB family. The encoded protein phosphorylates ribose to form ribose-5-phosphate in the presence of ATP and magnesium as a first step in ribose metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 89,963,559 (GRCm39) I72V probably benign Het
Aadacl3 G A 4: 144,182,640 (GRCm39) P276L possibly damaging Het
Acp6 T A 3: 97,075,305 (GRCm39) S180T probably benign Het
Adgrd1 A T 5: 129,221,053 (GRCm39) R449* probably null Het
Ak1 T C 2: 32,523,460 (GRCm39) V176A probably damaging Het
Capzb A T 4: 139,015,125 (GRCm39) D226V possibly damaging Het
Cd34 A T 1: 194,630,338 (GRCm39) probably benign Het
Cdh15 C A 8: 123,591,087 (GRCm39) D445E possibly damaging Het
Chil4 A G 3: 106,109,913 (GRCm39) F367L probably damaging Het
Clstn2 T C 9: 97,365,132 (GRCm39) Y458C probably damaging Het
Cplane2 A G 4: 140,944,696 (GRCm39) I82M probably benign Het
Ctsw T C 19: 5,518,486 (GRCm39) Y9C probably benign Het
Dhrs7 T C 12: 72,706,255 (GRCm39) D50G probably benign Het
Dnah14 A G 1: 181,584,799 (GRCm39) K3177E probably benign Het
Ehd1 T C 19: 6,327,251 (GRCm39) F83L probably benign Het
Eif5a2 G A 3: 28,836,886 (GRCm39) V59I possibly damaging Het
Emilin3 T A 2: 160,751,238 (GRCm39) probably null Het
Entpd8 A G 2: 24,975,066 (GRCm39) S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 (GRCm39) G493D probably damaging Het
Gm11596 C T 11: 99,683,698 (GRCm39) G141R unknown Het
Gpi-ps T G 8: 5,690,130 (GRCm39) noncoding transcript Het
H2-Q4 T C 17: 35,599,417 (GRCm39) Y167H probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Itpr1 A G 6: 108,382,490 (GRCm39) probably null Het
Kif2c A T 4: 117,032,066 (GRCm39) probably benign Het
Klrb1-ps1 C T 6: 129,096,751 (GRCm39) noncoding transcript Het
Krtap9-5 A T 11: 99,840,294 (GRCm39) T332S unknown Het
Lrrc39 A T 3: 116,373,189 (GRCm39) E283V probably benign Het
Mdga1 A G 17: 30,069,528 (GRCm39) S447P possibly damaging Het
Mindy1 G A 3: 95,202,710 (GRCm39) V425M probably benign Het
Mllt6 G A 11: 97,560,326 (GRCm39) S210N possibly damaging Het
Mrps5 T A 2: 127,442,772 (GRCm39) Y280* probably null Het
Muc3a T A 5: 137,244,997 (GRCm39) T159S probably damaging Het
Or10ad1b T A 15: 98,124,642 (GRCm39) I295F probably damaging Het
Or4a79 T A 2: 89,551,745 (GRCm39) T237S probably damaging Het
Or4f6 A T 2: 111,838,937 (GRCm39) M198K probably damaging Het
Pcdhga4 G A 18: 37,818,648 (GRCm39) V66I probably benign Het
Pdhx T C 2: 102,871,422 (GRCm39) T203A probably damaging Het
Pdss1 A G 2: 22,789,929 (GRCm39) probably null Het
Pdxk G T 10: 78,286,141 (GRCm39) Q103K probably benign Het
Peg3 A G 7: 6,711,419 (GRCm39) C1268R probably damaging Het
Pitpnc1 A T 11: 107,187,093 (GRCm39) S77T probably damaging Het
Pnisr T A 4: 21,874,990 (GRCm39) probably benign Het
Poc1b C T 10: 98,943,703 (GRCm39) T22I probably damaging Het
Ppfia1 G A 7: 144,060,001 (GRCm39) R604W probably damaging Het
Ppp1r3a A G 6: 14,754,680 (GRCm39) F189S probably damaging Het
Sh3rf2 G T 18: 42,186,989 (GRCm39) C36F probably damaging Het
Spock3 T A 8: 63,798,889 (GRCm39) N303K probably damaging Het
Tasor2 C T 13: 3,626,357 (GRCm39) V1198I probably benign Het
Tcaf2 T C 6: 42,606,401 (GRCm39) T518A probably benign Het
Tmem163 A T 1: 127,428,013 (GRCm39) V191D probably damaging Het
Trappc6b A G 12: 59,097,094 (GRCm39) V76A probably damaging Het
Ube2nl A G 7: 61,199,280 (GRCm39) noncoding transcript Het
Unc5d C T 8: 29,184,704 (GRCm39) V599M possibly damaging Het
Vmn1r184 A T 7: 25,966,346 (GRCm39) M31L probably benign Het
Vrtn C A 12: 84,696,248 (GRCm39) Q333K probably damaging Het
Zfp788 T A 7: 41,298,008 (GRCm39) F163I possibly damaging Het
Zfyve1 C T 12: 83,602,421 (GRCm39) R458H probably damaging Het
Other mutations in Rbks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Rbks APN 5 31,817,361 (GRCm39) missense probably damaging 1.00
IGL02618:Rbks APN 5 31,781,863 (GRCm39) nonsense probably null
IGL02678:Rbks APN 5 31,830,757 (GRCm39) missense probably damaging 1.00
IGL02719:Rbks APN 5 31,809,145 (GRCm39) intron probably benign
IGL02947:Rbks APN 5 31,817,407 (GRCm39) missense probably benign
R0334:Rbks UTSW 5 31,781,863 (GRCm39) nonsense probably null
R1441:Rbks UTSW 5 31,817,341 (GRCm39) missense probably benign
R2568:Rbks UTSW 5 31,823,096 (GRCm39) missense probably damaging 0.99
R4545:Rbks UTSW 5 31,781,912 (GRCm39) missense probably benign 0.10
R4546:Rbks UTSW 5 31,781,912 (GRCm39) missense probably benign 0.10
R4591:Rbks UTSW 5 31,817,352 (GRCm39) missense possibly damaging 0.52
R4833:Rbks UTSW 5 31,781,859 (GRCm39) missense probably benign 0.00
R4967:Rbks UTSW 5 31,781,876 (GRCm39) missense probably damaging 1.00
R5214:Rbks UTSW 5 31,807,736 (GRCm39) intron probably benign
R6051:Rbks UTSW 5 31,809,163 (GRCm39) missense probably damaging 1.00
R6194:Rbks UTSW 5 31,824,234 (GRCm39) missense probably benign 0.05
R6607:Rbks UTSW 5 31,805,136 (GRCm39) missense possibly damaging 0.92
R7246:Rbks UTSW 5 31,805,127 (GRCm39) missense possibly damaging 0.58
R8270:Rbks UTSW 5 31,807,810 (GRCm39) intron probably benign
R9070:Rbks UTSW 5 31,854,890 (GRCm39) missense probably benign 0.02
Z1177:Rbks UTSW 5 31,805,207 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATCCCACTATGCTCCAGGC -3'
(R):5'- TGGAGACCATTTCACAATATGAGG -3'

Sequencing Primer
(F):5'- GCTCCAGGCAACACCAGTAG -3'
(R):5'- AAACTGGCTCAGATTTCCCTGG -3'
Posted On 2016-06-21