Incidental Mutation 'R5076:Tcaf2'
ID395764
Institutional Source Beutler Lab
Gene Symbol Tcaf2
Ensembl Gene ENSMUSG00000029851
Gene NameTRPM8 channel-associated factor 2
SynonymsFam115c
MMRRC Submission 042665-MU
Accession Numbers

Ncbi RefSeq: NM_146174.1; MGI:2385258

Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R5076 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42623016-42645254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42629467 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 518 (T518A)
Ref Sequence ENSEMBL: ENSMUSP00000031879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031879]
Predicted Effect probably benign
Transcript: ENSMUST00000031879
AA Change: T518A

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031879
Gene: ENSMUSG00000029851
AA Change: T518A

DomainStartEndE-ValueType
low complexity region 515 526 N/A INTRINSIC
M60-like 543 842 4.85e-138 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131341
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,056,252 I72V probably benign Het
Aadacl3 G A 4: 144,456,070 P276L possibly damaging Het
Acp6 T A 3: 97,167,989 S180T probably benign Het
Adgrd1 A T 5: 129,143,989 R449* probably null Het
Ak1 T C 2: 32,633,448 V176A probably damaging Het
Capzb A T 4: 139,287,814 D226V possibly damaging Het
Cd34 A T 1: 194,948,030 probably benign Het
Cdh15 C A 8: 122,864,348 D445E possibly damaging Het
Chil4 A G 3: 106,202,597 F367L probably damaging Het
Clstn2 T C 9: 97,483,079 Y458C probably damaging Het
Ctsw T C 19: 5,468,458 Y9C probably benign Het
Dhrs7 T C 12: 72,659,481 D50G probably benign Het
Dnah14 A G 1: 181,757,234 K3177E probably benign Het
Ehd1 T C 19: 6,277,221 F83L probably benign Het
Eif5a2 G A 3: 28,782,737 V59I possibly damaging Het
Emilin3 T A 2: 160,909,318 probably null Het
Entpd8 A G 2: 25,085,054 S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 G493D probably damaging Het
Fam208b C T 13: 3,576,357 V1198I probably benign Het
Gm11596 C T 11: 99,792,872 G141R unknown Het
Gm1840 T G 8: 5,640,130 noncoding transcript Het
H2-Q4 T C 17: 35,380,441 Y167H probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Itpr1 A G 6: 108,405,529 probably null Het
Kif2c A T 4: 117,174,869 probably benign Het
Klrb1-ps1 C T 6: 129,119,788 noncoding transcript Het
Krtap9-5 A T 11: 99,949,468 T332S unknown Het
Lrrc39 A T 3: 116,579,540 E283V probably benign Het
Mdga1 A G 17: 29,850,554 S447P possibly damaging Het
Mindy1 G A 3: 95,295,399 V425M probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Muc3a T A 5: 137,210,540 T159S probably damaging Het
Olfr1252 T A 2: 89,721,401 T237S probably damaging Het
Olfr1310 A T 2: 112,008,592 M198K probably damaging Het
Olfr286 T A 15: 98,226,761 I295F probably damaging Het
Pcdhga4 G A 18: 37,685,595 V66I probably benign Het
Pdhx T C 2: 103,041,077 T203A probably damaging Het
Pdss1 A G 2: 22,899,917 probably null Het
Pdxk G T 10: 78,450,307 Q103K probably benign Het
Peg3 A G 7: 6,708,420 C1268R probably damaging Het
Pitpnc1 A T 11: 107,296,267 S77T probably damaging Het
Pnisr T A 4: 21,874,990 probably benign Het
Poc1b C T 10: 99,107,841 T22I probably damaging Het
Ppfia1 G A 7: 144,506,264 R604W probably damaging Het
Ppp1r3a A G 6: 14,754,681 F189S probably damaging Het
Rbks T A 5: 31,650,451 Y99* probably null Het
Rsg1 A G 4: 141,217,385 I82M probably benign Het
Sh3rf2 G T 18: 42,053,924 C36F probably damaging Het
Spock3 T A 8: 63,345,855 N303K probably damaging Het
Tmem163 A T 1: 127,500,276 V191D probably damaging Het
Trappc6b A G 12: 59,050,308 V76A probably damaging Het
Ube2nl A G 7: 61,549,532 noncoding transcript Het
Unc5d C T 8: 28,694,676 V599M possibly damaging Het
Vmn1r184 A T 7: 26,266,921 M31L probably benign Het
Vrtn C A 12: 84,649,474 Q333K probably damaging Het
Zfp788 T A 7: 41,648,584 F163I possibly damaging Het
Zfyve1 C T 12: 83,555,647 R458H probably damaging Het
Other mutations in Tcaf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tcaf2 APN 6 42630036 nonsense probably null
IGL00909:Tcaf2 APN 6 42624576 missense probably damaging 1.00
IGL01448:Tcaf2 APN 6 42630328 missense probably benign 0.05
IGL01870:Tcaf2 APN 6 42624477 missense possibly damaging 0.47
IGL02133:Tcaf2 APN 6 42627396 missense probably benign 0.06
IGL02208:Tcaf2 APN 6 42629086 missense probably damaging 1.00
IGL02666:Tcaf2 APN 6 42629124 splice site probably benign
PIT4260001:Tcaf2 UTSW 6 42642805 missense probably damaging 0.97
PIT4382001:Tcaf2 UTSW 6 42624366 makesense probably null
R0029:Tcaf2 UTSW 6 42630159 nonsense probably null
R0029:Tcaf2 UTSW 6 42630159 nonsense probably null
R0047:Tcaf2 UTSW 6 42629613 missense probably benign
R0047:Tcaf2 UTSW 6 42629613 missense probably benign
R0255:Tcaf2 UTSW 6 42642904 missense possibly damaging 0.95
R0617:Tcaf2 UTSW 6 42642511 missense probably damaging 0.97
R1387:Tcaf2 UTSW 6 42624578 missense probably damaging 1.00
R1523:Tcaf2 UTSW 6 42624451 nonsense probably null
R1529:Tcaf2 UTSW 6 42629506 missense probably benign 0.03
R1698:Tcaf2 UTSW 6 42628017 nonsense probably null
R1992:Tcaf2 UTSW 6 42629857 missense probably benign
R2065:Tcaf2 UTSW 6 42628047 missense probably benign 0.12
R2144:Tcaf2 UTSW 6 42642804 missense probably benign 0.45
R2435:Tcaf2 UTSW 6 42630364 missense possibly damaging 0.72
R2519:Tcaf2 UTSW 6 42629431 missense possibly damaging 0.92
R3979:Tcaf2 UTSW 6 42642547 missense probably damaging 1.00
R4093:Tcaf2 UTSW 6 42642838 missense probably damaging 1.00
R4532:Tcaf2 UTSW 6 42626437 missense probably damaging 1.00
R4780:Tcaf2 UTSW 6 42628062 missense probably damaging 1.00
R4906:Tcaf2 UTSW 6 42629745 missense probably benign 0.02
R4993:Tcaf2 UTSW 6 42642640 missense probably damaging 1.00
R5643:Tcaf2 UTSW 6 42642773 missense possibly damaging 0.85
R5644:Tcaf2 UTSW 6 42642773 missense possibly damaging 0.85
R5975:Tcaf2 UTSW 6 42642778 missense probably benign 0.22
R6234:Tcaf2 UTSW 6 42630374 missense probably benign
R6269:Tcaf2 UTSW 6 42627408 missense probably damaging 1.00
R6276:Tcaf2 UTSW 6 42629753 missense probably benign 0.04
R6375:Tcaf2 UTSW 6 42626178 missense probably damaging 0.99
R6523:Tcaf2 UTSW 6 42643019 missense probably benign 0.01
R6825:Tcaf2 UTSW 6 42629518 missense probably benign 0.05
R7039:Tcaf2 UTSW 6 42626140 missense probably damaging 1.00
R7099:Tcaf2 UTSW 6 42630341 missense probably benign 0.02
R7284:Tcaf2 UTSW 6 42629538 missense probably damaging 1.00
R7822:Tcaf2 UTSW 6 42629099 missense possibly damaging 0.95
R7964:Tcaf2 UTSW 6 42629706 missense probably benign
R8270:Tcaf2 UTSW 6 42630024 missense probably benign 0.30
R8505:Tcaf2 UTSW 6 42629541 missense probably benign 0.18
Y4339:Tcaf2 UTSW 6 42629472 missense probably benign
Y4341:Tcaf2 UTSW 6 42629472 missense probably benign
Z1177:Tcaf2 UTSW 6 42629616 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCATCCCAGGCTTAACTAAG -3'
(R):5'- TTATCTGTGCACCGGATCCTG -3'

Sequencing Primer
(F):5'- CTGGATCTCACTGTCTTGGAAAGATC -3'
(R):5'- CCGGATCCTGAGGAAGATACTGC -3'
Posted On2016-06-21