Incidental Mutation 'R5076:Zfp788'
ID 395769
Institutional Source Beutler Lab
Gene Symbol Zfp788
Ensembl Gene ENSMUSG00000074165
Gene Name zinc finger protein 788
Synonyms 2810426N06Rik
MMRRC Submission 042665-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R5076 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 41282955-41300305 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 41298008 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 163 (F163I)
Ref Sequence ENSEMBL: ENSMUSP00000132848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045720] [ENSMUST00000098508] [ENSMUST00000100275] [ENSMUST00000131180] [ENSMUST00000140964] [ENSMUST00000154942] [ENSMUST00000170770]
AlphaFold E9Q980
Predicted Effect probably benign
Transcript: ENSMUST00000045720
AA Change: F195I

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035499
Gene: ENSMUSG00000074165
AA Change: F195I

DomainStartEndE-ValueType
KRAB 4 67 7.82e-17 SMART
ZnF_C2H2 218 240 2.53e-2 SMART
ZnF_C2H2 246 268 2.71e-2 SMART
ZnF_C2H2 274 296 8.47e-4 SMART
ZnF_C2H2 302 324 3.16e-3 SMART
ZnF_C2H2 330 352 1.38e-3 SMART
ZnF_C2H2 358 380 4.54e-4 SMART
ZnF_C2H2 386 408 1.36e-2 SMART
ZnF_C2H2 414 436 2.24e-3 SMART
ZnF_C2H2 442 464 5.14e-3 SMART
ZnF_C2H2 470 492 5.14e-3 SMART
ZnF_C2H2 498 520 5.42e-2 SMART
ZnF_C2H2 526 548 8.6e-5 SMART
ZnF_C2H2 554 576 1.53e-1 SMART
ZnF_C2H2 582 604 2.4e-3 SMART
ZnF_C2H2 610 632 8.81e-2 SMART
ZnF_C2H2 638 660 9.58e-3 SMART
ZnF_C2H2 666 688 4.54e-4 SMART
ZnF_C2H2 694 716 1.1e-2 SMART
ZnF_C2H2 722 744 3.63e-3 SMART
ZnF_C2H2 750 772 8.94e-3 SMART
ZnF_C2H2 778 800 1.5e-4 SMART
ZnF_C2H2 806 828 4.24e-4 SMART
ZnF_C2H2 834 856 5.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098508
AA Change: F215I

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096108
Gene: ENSMUSG00000074165
AA Change: F215I

DomainStartEndE-ValueType
KRAB 24 87 7.82e-17 SMART
ZnF_C2H2 238 260 2.53e-2 SMART
ZnF_C2H2 266 288 2.71e-2 SMART
ZnF_C2H2 294 316 8.47e-4 SMART
ZnF_C2H2 322 344 3.16e-3 SMART
ZnF_C2H2 350 372 1.38e-3 SMART
ZnF_C2H2 378 400 4.54e-4 SMART
ZnF_C2H2 406 428 1.36e-2 SMART
ZnF_C2H2 434 456 2.24e-3 SMART
ZnF_C2H2 462 484 5.14e-3 SMART
ZnF_C2H2 490 512 5.14e-3 SMART
ZnF_C2H2 518 540 5.42e-2 SMART
ZnF_C2H2 546 568 8.6e-5 SMART
ZnF_C2H2 574 596 1.53e-1 SMART
ZnF_C2H2 602 624 2.4e-3 SMART
ZnF_C2H2 630 652 8.81e-2 SMART
ZnF_C2H2 658 680 9.58e-3 SMART
ZnF_C2H2 686 708 4.54e-4 SMART
ZnF_C2H2 714 736 1.1e-2 SMART
ZnF_C2H2 742 764 3.63e-3 SMART
ZnF_C2H2 770 792 8.94e-3 SMART
ZnF_C2H2 798 820 1.5e-4 SMART
ZnF_C2H2 826 848 4.24e-4 SMART
ZnF_C2H2 854 876 5.06e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100275
AA Change: F163I

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097847
Gene: ENSMUSG00000074165
AA Change: F163I

DomainStartEndE-ValueType
Blast:KRAB 1 35 1e-16 BLAST
ZnF_C2H2 186 208 2.53e-2 SMART
ZnF_C2H2 214 236 2.71e-2 SMART
ZnF_C2H2 242 264 8.47e-4 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
ZnF_C2H2 298 320 1.38e-3 SMART
ZnF_C2H2 326 348 4.54e-4 SMART
ZnF_C2H2 354 376 1.36e-2 SMART
ZnF_C2H2 382 404 2.24e-3 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 5.14e-3 SMART
ZnF_C2H2 466 488 5.42e-2 SMART
ZnF_C2H2 494 516 8.6e-5 SMART
ZnF_C2H2 522 544 1.53e-1 SMART
ZnF_C2H2 550 572 2.4e-3 SMART
ZnF_C2H2 578 600 8.81e-2 SMART
ZnF_C2H2 606 628 9.58e-3 SMART
ZnF_C2H2 634 656 4.54e-4 SMART
ZnF_C2H2 662 684 1.1e-2 SMART
ZnF_C2H2 690 712 3.63e-3 SMART
ZnF_C2H2 718 740 8.94e-3 SMART
ZnF_C2H2 746 768 1.5e-4 SMART
ZnF_C2H2 774 796 4.24e-4 SMART
ZnF_C2H2 802 824 5.06e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131180
SMART Domains Protein: ENSMUSP00000114542
Gene: ENSMUSG00000074165

DomainStartEndE-ValueType
KRAB 24 87 7.82e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140964
AA Change: F163I

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116050
Gene: ENSMUSG00000074165
AA Change: F163I

DomainStartEndE-ValueType
Blast:KRAB 1 35 4e-17 BLAST
ZnF_C2H2 186 208 2.53e-2 SMART
ZnF_C2H2 214 236 2.71e-2 SMART
ZnF_C2H2 242 264 8.47e-4 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154942
Predicted Effect possibly damaging
Transcript: ENSMUST00000170770
AA Change: F163I

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132848
Gene: ENSMUSG00000074165
AA Change: F163I

DomainStartEndE-ValueType
Blast:KRAB 1 35 1e-16 BLAST
ZnF_C2H2 186 208 2.53e-2 SMART
ZnF_C2H2 214 236 2.71e-2 SMART
ZnF_C2H2 242 264 8.47e-4 SMART
ZnF_C2H2 270 292 3.16e-3 SMART
ZnF_C2H2 298 320 1.38e-3 SMART
ZnF_C2H2 326 348 4.54e-4 SMART
ZnF_C2H2 354 376 1.36e-2 SMART
ZnF_C2H2 382 404 2.24e-3 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 5.14e-3 SMART
ZnF_C2H2 466 488 5.42e-2 SMART
ZnF_C2H2 494 516 8.6e-5 SMART
ZnF_C2H2 522 544 1.53e-1 SMART
ZnF_C2H2 550 572 2.4e-3 SMART
ZnF_C2H2 578 600 8.81e-2 SMART
ZnF_C2H2 606 628 9.58e-3 SMART
ZnF_C2H2 634 656 4.54e-4 SMART
ZnF_C2H2 662 684 1.1e-2 SMART
ZnF_C2H2 690 712 3.63e-3 SMART
ZnF_C2H2 718 740 8.94e-3 SMART
ZnF_C2H2 746 768 1.5e-4 SMART
ZnF_C2H2 774 796 4.24e-4 SMART
ZnF_C2H2 802 824 5.06e-2 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 89,963,559 (GRCm39) I72V probably benign Het
Aadacl3 G A 4: 144,182,640 (GRCm39) P276L possibly damaging Het
Acp6 T A 3: 97,075,305 (GRCm39) S180T probably benign Het
Adgrd1 A T 5: 129,221,053 (GRCm39) R449* probably null Het
Ak1 T C 2: 32,523,460 (GRCm39) V176A probably damaging Het
Capzb A T 4: 139,015,125 (GRCm39) D226V possibly damaging Het
Cd34 A T 1: 194,630,338 (GRCm39) probably benign Het
Cdh15 C A 8: 123,591,087 (GRCm39) D445E possibly damaging Het
Chil4 A G 3: 106,109,913 (GRCm39) F367L probably damaging Het
Clstn2 T C 9: 97,365,132 (GRCm39) Y458C probably damaging Het
Cplane2 A G 4: 140,944,696 (GRCm39) I82M probably benign Het
Ctsw T C 19: 5,518,486 (GRCm39) Y9C probably benign Het
Dhrs7 T C 12: 72,706,255 (GRCm39) D50G probably benign Het
Dnah14 A G 1: 181,584,799 (GRCm39) K3177E probably benign Het
Ehd1 T C 19: 6,327,251 (GRCm39) F83L probably benign Het
Eif5a2 G A 3: 28,836,886 (GRCm39) V59I possibly damaging Het
Emilin3 T A 2: 160,751,238 (GRCm39) probably null Het
Entpd8 A G 2: 24,975,066 (GRCm39) S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 (GRCm39) G493D probably damaging Het
Gm11596 C T 11: 99,683,698 (GRCm39) G141R unknown Het
Gpi-ps T G 8: 5,690,130 (GRCm39) noncoding transcript Het
H2-Q4 T C 17: 35,599,417 (GRCm39) Y167H probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Itpr1 A G 6: 108,382,490 (GRCm39) probably null Het
Kif2c A T 4: 117,032,066 (GRCm39) probably benign Het
Klrb1-ps1 C T 6: 129,096,751 (GRCm39) noncoding transcript Het
Krtap9-5 A T 11: 99,840,294 (GRCm39) T332S unknown Het
Lrrc39 A T 3: 116,373,189 (GRCm39) E283V probably benign Het
Mdga1 A G 17: 30,069,528 (GRCm39) S447P possibly damaging Het
Mindy1 G A 3: 95,202,710 (GRCm39) V425M probably benign Het
Mllt6 G A 11: 97,560,326 (GRCm39) S210N possibly damaging Het
Mrps5 T A 2: 127,442,772 (GRCm39) Y280* probably null Het
Muc3a T A 5: 137,244,997 (GRCm39) T159S probably damaging Het
Or10ad1b T A 15: 98,124,642 (GRCm39) I295F probably damaging Het
Or4a79 T A 2: 89,551,745 (GRCm39) T237S probably damaging Het
Or4f6 A T 2: 111,838,937 (GRCm39) M198K probably damaging Het
Pcdhga4 G A 18: 37,818,648 (GRCm39) V66I probably benign Het
Pdhx T C 2: 102,871,422 (GRCm39) T203A probably damaging Het
Pdss1 A G 2: 22,789,929 (GRCm39) probably null Het
Pdxk G T 10: 78,286,141 (GRCm39) Q103K probably benign Het
Peg3 A G 7: 6,711,419 (GRCm39) C1268R probably damaging Het
Pitpnc1 A T 11: 107,187,093 (GRCm39) S77T probably damaging Het
Pnisr T A 4: 21,874,990 (GRCm39) probably benign Het
Poc1b C T 10: 98,943,703 (GRCm39) T22I probably damaging Het
Ppfia1 G A 7: 144,060,001 (GRCm39) R604W probably damaging Het
Ppp1r3a A G 6: 14,754,680 (GRCm39) F189S probably damaging Het
Rbks T A 5: 31,807,795 (GRCm39) Y99* probably null Het
Sh3rf2 G T 18: 42,186,989 (GRCm39) C36F probably damaging Het
Spock3 T A 8: 63,798,889 (GRCm39) N303K probably damaging Het
Tasor2 C T 13: 3,626,357 (GRCm39) V1198I probably benign Het
Tcaf2 T C 6: 42,606,401 (GRCm39) T518A probably benign Het
Tmem163 A T 1: 127,428,013 (GRCm39) V191D probably damaging Het
Trappc6b A G 12: 59,097,094 (GRCm39) V76A probably damaging Het
Ube2nl A G 7: 61,199,280 (GRCm39) noncoding transcript Het
Unc5d C T 8: 29,184,704 (GRCm39) V599M possibly damaging Het
Vmn1r184 A T 7: 25,966,346 (GRCm39) M31L probably benign Het
Vrtn C A 12: 84,696,248 (GRCm39) Q333K probably damaging Het
Zfyve1 C T 12: 83,602,421 (GRCm39) R458H probably damaging Het
Other mutations in Zfp788
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB007:Zfp788 UTSW 7 41,299,049 (GRCm39) nonsense probably null
BB017:Zfp788 UTSW 7 41,299,049 (GRCm39) nonsense probably null
R0207:Zfp788 UTSW 7 41,299,020 (GRCm39) missense probably damaging 1.00
R0320:Zfp788 UTSW 7 41,298,971 (GRCm39) missense probably damaging 1.00
R0608:Zfp788 UTSW 7 41,297,705 (GRCm39) missense possibly damaging 0.53
R1184:Zfp788 UTSW 7 41,297,750 (GRCm39) missense probably damaging 1.00
R1483:Zfp788 UTSW 7 41,298,499 (GRCm39) nonsense probably null
R1985:Zfp788 UTSW 7 41,299,905 (GRCm39) missense probably damaging 0.98
R2030:Zfp788 UTSW 7 41,298,984 (GRCm39) missense probably damaging 1.00
R2207:Zfp788 UTSW 7 41,299,064 (GRCm39) missense probably damaging 0.99
R2313:Zfp788 UTSW 7 41,298,312 (GRCm39) missense probably damaging 0.99
R3791:Zfp788 UTSW 7 41,299,152 (GRCm39) missense probably damaging 0.99
R3872:Zfp788 UTSW 7 41,298,868 (GRCm39) nonsense probably null
R4126:Zfp788 UTSW 7 41,298,860 (GRCm39) missense probably damaging 0.97
R4579:Zfp788 UTSW 7 41,297,018 (GRCm39) missense probably benign 0.00
R4833:Zfp788 UTSW 7 41,296,992 (GRCm39) missense probably benign 0.31
R5175:Zfp788 UTSW 7 41,298,753 (GRCm39) missense probably damaging 1.00
R5225:Zfp788 UTSW 7 41,298,980 (GRCm39) missense probably benign 0.16
R5364:Zfp788 UTSW 7 41,299,551 (GRCm39) missense probably damaging 1.00
R5427:Zfp788 UTSW 7 41,299,076 (GRCm39) missense possibly damaging 0.82
R5484:Zfp788 UTSW 7 41,299,277 (GRCm39) missense probably damaging 0.96
R5659:Zfp788 UTSW 7 41,299,540 (GRCm39) nonsense probably null
R5917:Zfp788 UTSW 7 41,298,572 (GRCm39) missense probably benign
R6064:Zfp788 UTSW 7 41,297,878 (GRCm39) missense probably benign 0.18
R6128:Zfp788 UTSW 7 41,299,785 (GRCm39) missense probably damaging 1.00
R6144:Zfp788 UTSW 7 41,299,193 (GRCm39) missense probably damaging 0.97
R6182:Zfp788 UTSW 7 41,299,940 (GRCm39) missense probably damaging 0.98
R6299:Zfp788 UTSW 7 41,297,965 (GRCm39) missense possibly damaging 0.81
R6823:Zfp788 UTSW 7 41,298,984 (GRCm39) missense probably damaging 1.00
R6974:Zfp788 UTSW 7 41,299,301 (GRCm39) nonsense probably null
R7497:Zfp788 UTSW 7 41,298,275 (GRCm39) missense possibly damaging 0.92
R7930:Zfp788 UTSW 7 41,299,049 (GRCm39) nonsense probably null
R7979:Zfp788 UTSW 7 41,284,324 (GRCm39) critical splice donor site probably null
R8178:Zfp788 UTSW 7 41,298,335 (GRCm39) missense probably damaging 1.00
R8193:Zfp788 UTSW 7 41,298,038 (GRCm39) missense probably benign 0.35
R8195:Zfp788 UTSW 7 41,298,801 (GRCm39) missense probably benign 0.01
R8699:Zfp788 UTSW 7 41,297,840 (GRCm39) missense probably benign 0.13
R8964:Zfp788 UTSW 7 41,297,003 (GRCm39) missense probably damaging 1.00
R9037:Zfp788 UTSW 7 41,298,315 (GRCm39) missense probably damaging 0.99
R9122:Zfp788 UTSW 7 41,299,919 (GRCm39) nonsense probably null
R9133:Zfp788 UTSW 7 41,299,484 (GRCm39) missense
R9256:Zfp788 UTSW 7 41,299,638 (GRCm39) missense probably benign 0.03
R9372:Zfp788 UTSW 7 41,299,708 (GRCm39) nonsense probably null
R9570:Zfp788 UTSW 7 41,300,006 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGGTCTTATAACGTTTGTGCCACATC -3'
(R):5'- ATAAGGCTTTTCCTCAGTATGAGC -3'

Sequencing Primer
(F):5'- ATAACGTTTGTGCCACATCCTTTGG -3'
(R):5'- CTGAAAGCTTTACCACACTGTAGG -3'
Posted On 2016-06-21