Incidental Mutation 'R5076:Unc5d'
ID395773
Institutional Source Beutler Lab
Gene Symbol Unc5d
Ensembl Gene ENSMUSG00000063626
Gene Nameunc-5 netrin receptor D
SynonymsUnc5h4, D930029E11Rik
MMRRC Submission 042665-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R5076 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location28646717-29219636 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28694676 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 599 (V599M)
Ref Sequence ENSEMBL: ENSMUSP00000147306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168630] [ENSMUST00000209401] [ENSMUST00000210298] [ENSMUST00000210785] [ENSMUST00000211448]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168630
AA Change: V671M

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128521
Gene: ENSMUSG00000063626
AA Change: V671M

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
SCOP:d1cs6a2 52 146 5e-3 SMART
IGc2 169 236 2.66e-8 SMART
TSP1 253 304 2.29e-13 SMART
TSP1 309 358 6.33e-7 SMART
transmembrane domain 383 405 N/A INTRINSIC
Pfam:ZU5 545 642 1.6e-33 PFAM
DEATH 850 941 4.77e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209401
AA Change: V597M

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210298
AA Change: V610M

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210785
AA Change: V653M

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211448
AA Change: V599M

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.0866 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
MGI Phenotype PHENOTYPE: Mice exhibit impaired induced growth cone collapse response and accelerated radial migration of cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,056,252 I72V probably benign Het
Aadacl3 G A 4: 144,456,070 P276L possibly damaging Het
Acp6 T A 3: 97,167,989 S180T probably benign Het
Adgrd1 A T 5: 129,143,989 R449* probably null Het
Ak1 T C 2: 32,633,448 V176A probably damaging Het
Capzb A T 4: 139,287,814 D226V possibly damaging Het
Cd34 A T 1: 194,948,030 probably benign Het
Cdh15 C A 8: 122,864,348 D445E possibly damaging Het
Chil4 A G 3: 106,202,597 F367L probably damaging Het
Clstn2 T C 9: 97,483,079 Y458C probably damaging Het
Ctsw T C 19: 5,468,458 Y9C probably benign Het
Dhrs7 T C 12: 72,659,481 D50G probably benign Het
Dnah14 A G 1: 181,757,234 K3177E probably benign Het
Ehd1 T C 19: 6,277,221 F83L probably benign Het
Eif5a2 G A 3: 28,782,737 V59I possibly damaging Het
Emilin3 T A 2: 160,909,318 probably null Het
Entpd8 A G 2: 25,085,054 S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 G493D probably damaging Het
Fam208b C T 13: 3,576,357 V1198I probably benign Het
Gm11596 C T 11: 99,792,872 G141R unknown Het
Gm1840 T G 8: 5,640,130 noncoding transcript Het
H2-Q4 T C 17: 35,380,441 Y167H probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Itpr1 A G 6: 108,405,529 probably null Het
Kif2c A T 4: 117,174,869 probably benign Het
Klrb1-ps1 C T 6: 129,119,788 noncoding transcript Het
Krtap9-5 A T 11: 99,949,468 T332S unknown Het
Lrrc39 A T 3: 116,579,540 E283V probably benign Het
Mdga1 A G 17: 29,850,554 S447P possibly damaging Het
Mindy1 G A 3: 95,295,399 V425M probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Muc3a T A 5: 137,210,540 T159S probably damaging Het
Olfr1252 T A 2: 89,721,401 T237S probably damaging Het
Olfr1310 A T 2: 112,008,592 M198K probably damaging Het
Olfr286 T A 15: 98,226,761 I295F probably damaging Het
Pcdhga4 G A 18: 37,685,595 V66I probably benign Het
Pdhx T C 2: 103,041,077 T203A probably damaging Het
Pdss1 A G 2: 22,899,917 probably null Het
Pdxk G T 10: 78,450,307 Q103K probably benign Het
Peg3 A G 7: 6,708,420 C1268R probably damaging Het
Pitpnc1 A T 11: 107,296,267 S77T probably damaging Het
Pnisr T A 4: 21,874,990 probably benign Het
Poc1b C T 10: 99,107,841 T22I probably damaging Het
Ppfia1 G A 7: 144,506,264 R604W probably damaging Het
Ppp1r3a A G 6: 14,754,681 F189S probably damaging Het
Rbks T A 5: 31,650,451 Y99* probably null Het
Rsg1 A G 4: 141,217,385 I82M probably benign Het
Sh3rf2 G T 18: 42,053,924 C36F probably damaging Het
Spock3 T A 8: 63,345,855 N303K probably damaging Het
Tcaf2 T C 6: 42,629,467 T518A probably benign Het
Tmem163 A T 1: 127,500,276 V191D probably damaging Het
Trappc6b A G 12: 59,050,308 V76A probably damaging Het
Ube2nl A G 7: 61,549,532 noncoding transcript Het
Vmn1r184 A T 7: 26,266,921 M31L probably benign Het
Vrtn C A 12: 84,649,474 Q333K probably damaging Het
Zfp788 T A 7: 41,648,584 F163I possibly damaging Het
Zfyve1 C T 12: 83,555,647 R458H probably damaging Het
Other mutations in Unc5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Unc5d APN 8 28719826 missense probably damaging 0.97
IGL00687:Unc5d APN 8 28715813 splice site probably benign
IGL00970:Unc5d APN 8 28696428 missense probably benign 0.15
IGL01992:Unc5d APN 8 28652791 missense probably damaging 0.98
IGL02024:Unc5d APN 8 28652827 missense probably benign 0.08
IGL02080:Unc5d APN 8 28891288 splice site probably null
IGL02902:Unc5d APN 8 28875606 missense probably damaging 1.00
IGL02982:Unc5d APN 8 28652853 missense probably damaging 1.00
R0071:Unc5d UTSW 8 28719826 missense possibly damaging 0.62
R0071:Unc5d UTSW 8 28719826 missense possibly damaging 0.62
R0761:Unc5d UTSW 8 28696532 splice site probably null
R0941:Unc5d UTSW 8 28759027 missense possibly damaging 0.85
R1086:Unc5d UTSW 8 28875630 missense possibly damaging 0.87
R1625:Unc5d UTSW 8 28683206 missense probably damaging 1.00
R1635:Unc5d UTSW 8 28760749 missense probably benign 0.14
R1682:Unc5d UTSW 8 28759081 missense probably damaging 1.00
R1698:Unc5d UTSW 8 28696478 missense probably damaging 0.99
R2015:Unc5d UTSW 8 28758979 missense probably damaging 1.00
R2132:Unc5d UTSW 8 28875529 missense possibly damaging 0.50
R2174:Unc5d UTSW 8 28694540 missense probably damaging 0.99
R2210:Unc5d UTSW 8 28761797 missense probably damaging 0.97
R3684:Unc5d UTSW 8 28694592 missense probably damaging 1.00
R3734:Unc5d UTSW 8 28761798 missense probably benign 0.02
R4093:Unc5d UTSW 8 28844837 missense possibly damaging 0.87
R4287:Unc5d UTSW 8 28719796 missense probably benign 0.00
R4888:Unc5d UTSW 8 28666899 missense probably benign 0.02
R5000:Unc5d UTSW 8 28715747 missense possibly damaging 0.90
R5060:Unc5d UTSW 8 28719695 missense probably benign 0.00
R5696:Unc5d UTSW 8 28666842 missense probably benign 0.06
R6024:Unc5d UTSW 8 28875511 missense possibly damaging 0.96
R6077:Unc5d UTSW 8 28675307 missense possibly damaging 0.94
R6259:Unc5d UTSW 8 28666792 missense probably benign 0.00
R6387:Unc5d UTSW 8 28875526 nonsense probably null
R7038:Unc5d UTSW 8 28715721 critical splice donor site probably null
R7577:Unc5d UTSW 8 28891421 missense probably damaging 1.00
R7641:Unc5d UTSW 8 28719975 missense probably damaging 1.00
R8175:Unc5d UTSW 8 28844827 missense probably damaging 1.00
R8426:Unc5d UTSW 8 28719988 missense probably damaging 1.00
X0058:Unc5d UTSW 8 28760730 missense probably benign 0.12
X0060:Unc5d UTSW 8 28694676 missense possibly damaging 0.88
Z1176:Unc5d UTSW 8 28759053 missense probably damaging 1.00
Z1177:Unc5d UTSW 8 28891308 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAACTGTAACAAGACTGACCTGAAATG -3'
(R):5'- TGCCTCCAGCTGTTATCTTAATAG -3'

Sequencing Primer
(F):5'- TGCACAAGGAGTATTGTCCAC -3'
(R):5'- GGTGTTTCCAAACTGAGAG -3'
Posted On2016-06-21