Mutagenetix > Incidental Mutation

Incidental Mutation 'R5076:Spock3'

395774

Institutional Source

Beutler Lab

Gene Symbol

Spock3

Ensembl Gene

ENSMUSG00000054162

Gene Name

sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3

Synonyms

testican 3, 2900045C01Rik

MMRRC Submission

042665-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5076 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62951009-63357103 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 63345855 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 303 (N303K)

Ref Sequence

ENSEMBL: ENSMUSP00000112930 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093480] [ENSMUST00000117377] [ENSMUST00000118003] [ENSMUST00000119068]

AlphaFold

Q8BKV0

Predicted Effect

probably damaging
Transcript: ENSMUST00000093480
AA Change: N303K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000091192
Gene: ENSMUSG00000054162
AA Change: N303K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
KAZAL	138	183	2.74e-11	SMART
Pfam:SPARC_Ca_bdg	198	308	8.5e-35	PFAM
TY	338	384	2.27e-17	SMART
low complexity region	403	434	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000117377
AA Change: N300K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113797
Gene: ENSMUSG00000054162
AA Change: N300K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
KAZAL	135	180	2.74e-11	SMART
Pfam:SPARC_Ca_bdg	195	305	5e-35	PFAM
TY	335	381	2.27e-17	SMART
low complexity region	400	431	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000118003
AA Change: N303K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113683
Gene: ENSMUSG00000054162
AA Change: N303K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
KAZAL	138	183	2.74e-11	SMART
Pfam:SPARC_Ca_bdg	198	308	1.1e-36	PFAM
TY	338	384	2.27e-17	SMART
low complexity region	403	434	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119068
AA Change: N303K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112930
Gene: ENSMUSG00000054162
AA Change: N303K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
KAZAL	138	183	2.74e-11	SMART
Pfam:SPARC_Ca_bdg	198	308	8.5e-35	PFAM
TY	338	384	2.27e-17	SMART
low complexity region	403	434	N/A	INTRINSIC

Meta Mutation Damage Score

0.1385

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.0%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a novel family of calcium-binding proteoglycan proteins that contain thyroglobulin type-1 and Kazal-like domains. The encoded protein and may play a role in adult T-cell leukemia by inhibiting the activity of membrane-type matrix metalloproteinases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious morphological or behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933434E20Rik	A	G	3: 90,056,252	I72V	probably benign	Het
Aadacl3	G	A	4: 144,456,070	P276L	possibly damaging	Het
Acp6	T	A	3: 97,167,989	S180T	probably benign	Het
Adgrd1	A	T	5: 129,143,989	R449*	probably null	Het
Ak1	T	C	2: 32,633,448	V176A	probably damaging	Het
Capzb	A	T	4: 139,287,814	D226V	possibly damaging	Het
Cd34	A	T	1: 194,948,030		probably benign	Het
Cdh15	C	A	8: 122,864,348	D445E	possibly damaging	Het
Chil4	A	G	3: 106,202,597	F367L	probably damaging	Het
Clstn2	T	C	9: 97,483,079	Y458C	probably damaging	Het
Ctsw	T	C	19: 5,468,458	Y9C	probably benign	Het
Dhrs7	T	C	12: 72,659,481	D50G	probably benign	Het
Dnah14	A	G	1: 181,757,234	K3177E	probably benign	Het
Ehd1	T	C	19: 6,277,221	F83L	probably benign	Het
Eif5a2	G	A	3: 28,782,737	V59I	possibly damaging	Het
Emilin3	T	A	2: 160,909,318		probably null	Het
Entpd8	A	G	2: 25,085,054	S426G	possibly damaging	Het
Epb41l4b	C	T	4: 57,040,984	G493D	probably damaging	Het
Fam208b	C	T	13: 3,576,357	V1198I	probably benign	Het
Gm11596	C	T	11: 99,792,872	G141R	unknown	Het
Gm1840	T	G	8: 5,640,130		noncoding transcript	Het
H2-Q4	T	C	17: 35,380,441	Y167H	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Itpr1	A	G	6: 108,405,529		probably null	Het
Kif2c	A	T	4: 117,174,869		probably benign	Het
Klrb1-ps1	C	T	6: 129,119,788		noncoding transcript	Het
Krtap9-5	A	T	11: 99,949,468	T332S	unknown	Het
Lrrc39	A	T	3: 116,579,540	E283V	probably benign	Het
Mdga1	A	G	17: 29,850,554	S447P	possibly damaging	Het
Mindy1	G	A	3: 95,295,399	V425M	probably benign	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Mrps5	T	A	2: 127,600,852	Y280*	probably null	Het
Muc3a	T	A	5: 137,210,540	T159S	probably damaging	Het
Olfr1252	T	A	2: 89,721,401	T237S	probably damaging	Het
Olfr1310	A	T	2: 112,008,592	M198K	probably damaging	Het
Olfr286	T	A	15: 98,226,761	I295F	probably damaging	Het
Pcdhga4	G	A	18: 37,685,595	V66I	probably benign	Het
Pdhx	T	C	2: 103,041,077	T203A	probably damaging	Het
Pdss1	A	G	2: 22,899,917		probably null	Het
Pdxk	G	T	10: 78,450,307	Q103K	probably benign	Het
Peg3	A	G	7: 6,708,420	C1268R	probably damaging	Het
Pitpnc1	A	T	11: 107,296,267	S77T	probably damaging	Het
Pnisr	T	A	4: 21,874,990		probably benign	Het
Poc1b	C	T	10: 99,107,841	T22I	probably damaging	Het
Ppfia1	G	A	7: 144,506,264	R604W	probably damaging	Het
Ppp1r3a	A	G	6: 14,754,681	F189S	probably damaging	Het
Rbks	T	A	5: 31,650,451	Y99*	probably null	Het
Rsg1	A	G	4: 141,217,385	I82M	probably benign	Het
Sh3rf2	G	T	18: 42,053,924	C36F	probably damaging	Het
Tcaf2	T	C	6: 42,629,467	T518A	probably benign	Het
Tmem163	A	T	1: 127,500,276	V191D	probably damaging	Het
Trappc6b	A	G	12: 59,050,308	V76A	probably damaging	Het
Ube2nl	A	G	7: 61,549,532		noncoding transcript	Het
Unc5d	C	T	8: 28,694,676	V599M	possibly damaging	Het
Vmn1r184	A	T	7: 26,266,921	M31L	probably benign	Het
Vrtn	C	A	12: 84,649,474	Q333K	probably damaging	Het
Zfp788	T	A	7: 41,648,584	F163I	possibly damaging	Het
Zfyve1	C	T	12: 83,555,647	R458H	probably damaging	Het

Other mutations in Spock3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01093:Spock3	APN	8	63348959	missense	probably benign	0.01
IGL01716:Spock3	APN	8	63355350	missense	unknown
IGL02058:Spock3	APN	8	63245198	nonsense	probably null
IGL02450:Spock3	APN	8	63245215	critical splice donor site	probably null
IGL02610:Spock3	APN	8	63345737	missense	probably damaging	1.00
IGL03046:Spock3	UTSW	8	63348984	critical splice donor site	probably null
R0044:Spock3	UTSW	8	63144007	missense	possibly damaging	0.90
R0044:Spock3	UTSW	8	63144007	missense	possibly damaging	0.90
R0084:Spock3	UTSW	8	63143929	missense	probably damaging	1.00
R1422:Spock3	UTSW	8	63143989	missense	possibly damaging	0.89
R1469:Spock3	UTSW	8	62951900	missense	probably damaging	0.99
R1469:Spock3	UTSW	8	62951900	missense	probably damaging	0.99
R1484:Spock3	UTSW	8	63220705	missense	probably damaging	1.00
R1728:Spock3	UTSW	8	63348977	missense	probably damaging	0.99
R1729:Spock3	UTSW	8	63348977	missense	probably damaging	0.99
R1739:Spock3	UTSW	8	63348947	missense	probably damaging	0.99
R2057:Spock3	UTSW	8	63245170	nonsense	probably null
R2340:Spock3	UTSW	8	63345713	missense	probably damaging	1.00
R3732:Spock3	UTSW	8	63345699	missense	probably damaging	1.00
R3732:Spock3	UTSW	8	63345699	missense	probably damaging	1.00
R3733:Spock3	UTSW	8	63345699	missense	probably damaging	1.00
R3763:Spock3	UTSW	8	63144015	critical splice donor site	probably null
R5000:Spock3	UTSW	8	63245124	missense	possibly damaging	0.86
R5069:Spock3	UTSW	8	63355265	missense	probably benign	0.01
R5232:Spock3	UTSW	8	63345809	missense	probably damaging	1.00
R5329:Spock3	UTSW	8	63345782	missense	probably damaging	1.00
R5621:Spock3	UTSW	8	63144006	missense	probably benign	0.19
R5882:Spock3	UTSW	8	63143931	missense	probably benign	0.03
R5888:Spock3	UTSW	8	63355300	missense	unknown
R5902:Spock3	UTSW	8	63355302	missense	unknown
R6991:Spock3	UTSW	8	63355381	makesense	probably null
R7317:Spock3	UTSW	8	63113556	missense	possibly damaging	0.52
R7970:Spock3	UTSW	8	63345715	missense	probably damaging	1.00
R8030:Spock3	UTSW	8	63352198	missense	probably damaging	1.00
R8392:Spock3	UTSW	8	63355311	missense	unknown
R8889:Spock3	UTSW	8	62951952	nonsense	probably null
R8892:Spock3	UTSW	8	62951952	nonsense	probably null
R9065:Spock3	UTSW	8	63348955	missense	probably damaging	0.98
R9199:Spock3	UTSW	8	63345730	missense	probably damaging	1.00
R9377:Spock3	UTSW	8	63345712	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTTGCAAGGATTCACTTGGC -3'
(R):5'- CTGCTTGCGGGTTCATAATG -3'

Sequencing Primer
(F):5'- CACTTGGCTGGATGTTTAATAGAC -3'
(R):5'- CTTGCGGGTTCATAATGGGAAC -3'

Posted On

2016-06-21