Mutagenetix > Incidental Mutation

Incidental Mutation 'R5076:Cdh15'

395775

Institutional Source

Beutler Lab

Gene Symbol

Cdh15

Ensembl Gene

ENSMUSG00000031962

Gene Name

cadherin 15

Synonyms

M cadherin, Mcad, Cdh14

MMRRC Submission

042665-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5076 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122847966-122867397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 122864348 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 445 (D445E)

Ref Sequence

ENSEMBL: ENSMUSP00000034443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]

AlphaFold

P33146

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034443
AA Change: D445E

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: D445E

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	64	149	5.95e-18	SMART
CA	173	257	3.09e-25	SMART
CA	280	373	2.5e-11	SMART
CA	396	480	3.45e-14	SMART
Pfam:Cadherin	486	579	5.2e-9	PFAM
transmembrane domain	603	625	N/A	INTRINSIC
Pfam:Cadherin_C	633	783	6.7e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.0%

Validation Efficiency

97% (66/68)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933434E20Rik	A	G	3: 90,056,252	I72V	probably benign	Het
Aadacl3	G	A	4: 144,456,070	P276L	possibly damaging	Het
Acp6	T	A	3: 97,167,989	S180T	probably benign	Het
Adgrd1	A	T	5: 129,143,989	R449*	probably null	Het
Ak1	T	C	2: 32,633,448	V176A	probably damaging	Het
Capzb	A	T	4: 139,287,814	D226V	possibly damaging	Het
Cd34	A	T	1: 194,948,030		probably benign	Het
Chil4	A	G	3: 106,202,597	F367L	probably damaging	Het
Clstn2	T	C	9: 97,483,079	Y458C	probably damaging	Het
Ctsw	T	C	19: 5,468,458	Y9C	probably benign	Het
Dhrs7	T	C	12: 72,659,481	D50G	probably benign	Het
Dnah14	A	G	1: 181,757,234	K3177E	probably benign	Het
Ehd1	T	C	19: 6,277,221	F83L	probably benign	Het
Eif5a2	G	A	3: 28,782,737	V59I	possibly damaging	Het
Emilin3	T	A	2: 160,909,318		probably null	Het
Entpd8	A	G	2: 25,085,054	S426G	possibly damaging	Het
Epb41l4b	C	T	4: 57,040,984	G493D	probably damaging	Het
Fam208b	C	T	13: 3,576,357	V1198I	probably benign	Het
Gm11596	C	T	11: 99,792,872	G141R	unknown	Het
Gm1840	T	G	8: 5,640,130		noncoding transcript	Het
H2-Q4	T	C	17: 35,380,441	Y167H	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Itpr1	A	G	6: 108,405,529		probably null	Het
Kif2c	A	T	4: 117,174,869		probably benign	Het
Klrb1-ps1	C	T	6: 129,119,788		noncoding transcript	Het
Krtap9-5	A	T	11: 99,949,468	T332S	unknown	Het
Lrrc39	A	T	3: 116,579,540	E283V	probably benign	Het
Mdga1	A	G	17: 29,850,554	S447P	possibly damaging	Het
Mindy1	G	A	3: 95,295,399	V425M	probably benign	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Mrps5	T	A	2: 127,600,852	Y280*	probably null	Het
Muc3a	T	A	5: 137,210,540	T159S	probably damaging	Het
Olfr1252	T	A	2: 89,721,401	T237S	probably damaging	Het
Olfr1310	A	T	2: 112,008,592	M198K	probably damaging	Het
Olfr286	T	A	15: 98,226,761	I295F	probably damaging	Het
Pcdhga4	G	A	18: 37,685,595	V66I	probably benign	Het
Pdhx	T	C	2: 103,041,077	T203A	probably damaging	Het
Pdss1	A	G	2: 22,899,917		probably null	Het
Pdxk	G	T	10: 78,450,307	Q103K	probably benign	Het
Peg3	A	G	7: 6,708,420	C1268R	probably damaging	Het
Pitpnc1	A	T	11: 107,296,267	S77T	probably damaging	Het
Pnisr	T	A	4: 21,874,990		probably benign	Het
Poc1b	C	T	10: 99,107,841	T22I	probably damaging	Het
Ppfia1	G	A	7: 144,506,264	R604W	probably damaging	Het
Ppp1r3a	A	G	6: 14,754,681	F189S	probably damaging	Het
Rbks	T	A	5: 31,650,451	Y99*	probably null	Het
Rsg1	A	G	4: 141,217,385	I82M	probably benign	Het
Sh3rf2	G	T	18: 42,053,924	C36F	probably damaging	Het
Spock3	T	A	8: 63,345,855	N303K	probably damaging	Het
Tcaf2	T	C	6: 42,629,467	T518A	probably benign	Het
Tmem163	A	T	1: 127,500,276	V191D	probably damaging	Het
Trappc6b	A	G	12: 59,050,308	V76A	probably damaging	Het
Ube2nl	A	G	7: 61,549,532		noncoding transcript	Het
Unc5d	C	T	8: 28,694,676	V599M	possibly damaging	Het
Vmn1r184	A	T	7: 26,266,921	M31L	probably benign	Het
Vrtn	C	A	12: 84,649,474	Q333K	probably damaging	Het
Zfp788	T	A	7: 41,648,584	F163I	possibly damaging	Het
Zfyve1	C	T	12: 83,555,647	R458H	probably damaging	Het

Other mutations in Cdh15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cdh15	APN	8	122865323	intron	probably benign
IGL01958:Cdh15	APN	8	122859350	missense	probably damaging	1.00
IGL02588:Cdh15	APN	8	122856552	nonsense	probably null
IGL02793:Cdh15	APN	8	122860982	missense	probably damaging	1.00
IGL02947:Cdh15	APN	8	122865372	missense	probably benign	0.00
R0310:Cdh15	UTSW	8	122865436	missense	probably damaging	1.00
R0441:Cdh15	UTSW	8	122860966	missense	probably damaging	1.00
R0766:Cdh15	UTSW	8	122861449	intron	probably benign
R0898:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1023:Cdh15	UTSW	8	122865200	missense	probably damaging	0.98
R1054:Cdh15	UTSW	8	122864337	missense	possibly damaging	0.85
R1072:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R1081:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1101:Cdh15	UTSW	8	122860846	missense	possibly damaging	0.93
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1208:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1209:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1210:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1312:Cdh15	UTSW	8	122861449	intron	probably benign
R1317:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1318:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1393:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1428:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1429:Cdh15	UTSW	8	122857495	missense	probably damaging	1.00
R1695:Cdh15	UTSW	8	122862016	missense	probably benign	0.05
R2157:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2170:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2178:Cdh15	UTSW	8	122864976	splice site	probably null
R2252:Cdh15	UTSW	8	122857422	missense	probably damaging	1.00
R2290:Cdh15	UTSW	8	122859317	missense	probably damaging	1.00
R2317:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2330:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2345:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2349:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2353:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2354:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2566:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2567:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2568:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2893:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2894:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R2937:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2938:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2990:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2992:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R2993:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3029:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3030:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3195:Cdh15	UTSW	8	122856635	missense	probably benign	0.10
R3441:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3442:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3608:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R3686:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4119:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4120:Cdh15	UTSW	8	122863423	missense	probably damaging	1.00
R4477:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4478:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4480:Cdh15	UTSW	8	122864676	missense	probably benign	0.00
R4580:Cdh15	UTSW	8	122865158	missense	probably damaging	0.99
R4583:Cdh15	UTSW	8	122865028	missense	probably damaging	0.98
R4619:Cdh15	UTSW	8	122860873	missense	probably damaging	1.00
R4694:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R4731:Cdh15	UTSW	8	122862024	missense	probably damaging	1.00
R5347:Cdh15	UTSW	8	122862063	missense	probably null	1.00
R5375:Cdh15	UTSW	8	122865100	missense	probably damaging	1.00
R5498:Cdh15	UTSW	8	122865178	missense	possibly damaging	0.79
R5778:Cdh15	UTSW	8	122856587	missense	possibly damaging	0.80
R6320:Cdh15	UTSW	8	122864347	missense	probably benign	0.01
R6570:Cdh15	UTSW	8	122857391	missense	probably damaging	1.00
R6708:Cdh15	UTSW	8	122863555	missense	probably benign	0.32
R7505:Cdh15	UTSW	8	122848492	missense	probably benign	0.01
R7527:Cdh15	UTSW	8	122862126	missense	probably damaging	1.00
R7724:Cdh15	UTSW	8	122866961	missense	probably damaging	1.00
R8093:Cdh15	UTSW	8	122866835	missense	probably damaging	1.00
R8485:Cdh15	UTSW	8	122857366	missense	probably damaging	1.00
R8759:Cdh15	UTSW	8	122860889	missense	probably damaging	1.00
R8910:Cdh15	UTSW	8	122848501	missense	probably benign	0.04
R9017:Cdh15	UTSW	8	122857517	critical splice donor site	probably null
R9453:Cdh15	UTSW	8	122859290	missense	probably damaging	0.99
R9699:Cdh15	UTSW	8	122862030	missense	probably benign	0.00
R9705:Cdh15	UTSW	8	122864285	missense	probably damaging	1.00
Z1176:Cdh15	UTSW	8	122864259	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCAGGTCACATATGGGTATG -3'
(R):5'- TAGGATCTCGATGGACAGGG -3'

Sequencing Primer
(F):5'- ATGTCTAGGCATCTTGGG -3'
(R):5'- TACCCTGTCAGTTGTCCA -3'

Posted On

2016-06-21